Description :
From Genome Similarity Track
Location :
contig_96:126648- 128038
Transcript NameFunction/comments
g10871.t1hypothetical protein PHYSODRAFT_246485
g10872.t1hypothetical protein PHYSODRAFT_246485

Sequence
1390 bases(100 bases per row)
GACCAACGCCGACGACTCGATTCTGTCGGAGGAGGCGGCAGAGGACTTCGACCCGTTCTTCGAGTACGTGCTGCTGGGCGACACGGTGTCGGACGGCGTG
CTGGCCTGGATCTCTGTCGGCGTGGACATGACTCAGGCGCAGACCATCACGGCCGCGGGCACACTGACGGCGGACGGTGGCGTCATGGCCGACTCGACGG
GCACGACGACTGGCGGCGGGGGTGGCGGTGGCATGGGAGGAGGCTCGGACATGGCCGGTGGCTTCGGCGGATCCGTCGGCGGACCGGAGAGTGGCAACGG
CAGTGTATCGCTGGGCGCTTGGGTGCTTGAAACACTGTCTGAGGAAGTGGTCGTGGTTGTCGAGCCCATTTGAACGCGTGCATAGTCAAGCAAATGAACA
GTAAAATGTGATGTAGTGATACAAGAGTGAGGGCGACCCGCGCTAATAAACGGTTTGTCTACGATTCGAGTGTTGGCGAGGTGGCACCGACTGTGAGTGC
AGGCCTGTCGAATCGAATCGTTGTTTGGCGCGCGAGTGGTGTGATGTTGGCAACAACGTGTTGCTGGGTCGATTCAATGGACCAGTCGACTCGATTGGTC
TGTGGTGGCTTCATTATTGTCAGGTCGAGGTGACGATGCCAACTTGGATTTAGTATGCCTCAAGTTGAAGTTGGACTCCGGAGCTCTTCGATGTGGCTCT
GCAATGTGGCTCTTCAATGTGGTTCTTCCAGCACTCTCCAAACGACCACGACTCCAAACGACTCAAACGATCACGTTACGTAAACGACCACCTTCTCCAA
ACGACCACCGTGCGTAATCAATCGACAACGCTTGAGCGCTCGACCGCCTCCAAACACGAACAGCAGCACTTATACAAACGTGAACAAACGGTATTACTCC
TGTATCTAGCTTTACAAATGCAACACTCCGCACCATACGCGAGACTACATCTACTCCATTCAGACGACGGGTTTCTGGTCTGGAGACGCCTCCGCCTCCG
CCTTTGTAGCGGTGGGGTTGCCGTCTGACTTGTCCGTGGACGTGGCATCTGCCTCCGACGAGTACGCTTGCTTGCCGGCGTCGGCCGACGTCAATGTCGA
CGGTAGACCCAGGCCGTCCGTGAGTCCAGAGAGGCCGCTTGTGATGCCTTCGTCGAGTCCGCTCCGTAGCTGCCACTGATGGGTAAGCCCAGCAACGATG
GCAGCTTGCCGCCTTTCATCAGACTGCTCATGATGCCGTTCGTGATCGAGCCGAGTCCGTTTCCCGTCGGTGATCGTTTGGAGAGTGCTGGAAGCGCCAC
ATTGAAGAGCCACATTGCAGAGCCACATTGCAGAGCCACATCGAAGAGCTCCGGAGTCCAACTTCAACTTGAGGCATACTAAATCCAAGT