Description :
From Genome Similarity Track
Location :
Scaffold_17:126619- 131418
Transcript NameFunction/comments
Hyaar_Emoy2803050Folate-Biopterin Transporter (FBT) Family
Hyaar_Emoy2803051peptidase M24
Hyaar_Emoy2803052hypothetical protein

Sequence
4799 bases(100 bases per row)
AGATATCACCGTGCTTGACAATGCTGATTTGAGGCGACTCAATGTCCAGCCACGACGGGATTTGGCCATCAGTGACCACGTAAATGTGGCGCACCCAAGG
CGCGTATTTCTCCAGTGATCGGAGCGAGTACCGGAGCTCTTCATTGTCTCGGAATCGATTGTCCGCGTTCGAATCGTCGTTCCCCTTCACATCTGCGTCT
TGTCCCCACACGGGCAGCGGTTGACCCGTTAAGGACGCGATCCAGTGCTTGTGCCAGAACTCCTTCTCTTTCTTCCATCGCGGGTCCGTGCCGTTGACCC
ACGTATACACGACGTCGATTGGTCCATAAGCCAAGAACTCGGACGACGGGACGTTGCCAATGTTCCTGCGGTCCACAGGCTGCCAATCGCTGACGAGGAA
GACGAAGTATGTAGCCAAGACACCAGAGAAGAAGATGACGAGGAGCGACCAGCTGCCGCGGTGCGCGAAACGGCTGGAAACAGGCGTGGCGACGTGCGAC
TGGGGCGCCGTCATTGTTTGACGCTTGATGTGGGTGGCAAGTCGCGACTTCATAAAGTAACGGGATGGTGTGTCAGAAGTAACACGAGGGATTGGTTATT
AATGCTTCCGATGATGTATCGTGTTTGAAAGGGAAGTGAAAAGAGACGTATTTGGTCTGACAGGTCGAAGCGCAGCGCTAGCTGGTTTTAGGACTTGATT
CAGGTACGGGTTTGAGCTCAAAGTCGTTAAGAGTCAACTTGGCCGTCATTTTCTACAGTAGCAACGAGATAGATACGCACACAATACAGCAGTAGGAGTT
CAGTATAAATGCGGACTGAAAGCATCGGTCCAACGCCTAGCTCTTGGTACATCGTCTACATGGATAAACTCCGTATTTTCTGGTGGGTCCATCGTCACCC
CCGTAGAGAACACACGAACAAGTACTACTAATATGTCAACCAACACAAAGAGAGACGCACCTTGTGCTCTTCCTCCAGGTTGAAAATGTGCTCTGACTGA
CTTTTGACCACGTGATCTCGCGCCTCATACTTGCCACTGACAAACTGGACGGTCCAACACAACCAAAAAAAACAAAAGATCAGCAGGTTTTGCGATGCCA
GGAAGACCACTACTGTGAGCATTTTATCCACTGAACCTGCGTCAGAGCCACGTATCCGCCGACGATAAAGAGAACAAGCGGAAGTCCTGCGGTGGCAAAG
TGGTTTTTCTTCTTGTGGTGCTTCTTCTGCGCCGTTGACGTCGTAGTGGAGAAGGCCCGACGTAGCGTCGACGTAATCATTTTAGTGCAAAAGGTTCTGC
TTATTTGAGTCCCAAGTAGCACGGATGTGACAGTTGTTTTTGCTTTTGCACCAATCAGAGGTCGGATCGTCGACCACAACTCGTCCAGCTTTGCATGAAA
TCGCGATGCCAAAAGTAACAGCCAAGCAATATCTGACCCTTTTTAGCGCAACTCTGGGTTCCCTCTTTGCGGGATCGAGCGCCATGCATGCAATTCTTAA
GCCAGATCTGGTGAGCTCTCAATGCGGTATATTCTCCATGATGGTAACATCACTCGGTGATTAATGAACTGGTACTTGATCTAGACCATTCCGGACCTGA
GTGATGGGGAAAACAGCATGAAAACTCCTTCAGAAGACGGTGATAGCCACTGAATGAACAATGGGTAGAGCATCCACGACCGCGAGTATTTACGTGACAC
ACAAGTGCTTTGGACCACCATATGGCTTTTCTCTTTTTTATCGTACTGATAGAATGGCGCGAGGCGTCCTGCTCATTTTAACGGATTTCGTAAATGATTA
TCGGACGACGATTTGAGTAGTAAATGTATTGAACGTGGCAGGACCTGATGTGGTTCAAAGTGTCGAATGTCGTCGGTGTGTGGTCTCTGACGATCGATAA
GAGACCCCGTAGATGTGCTAGCGGCTAAGCGATGCTGTGTCAGCAAGGTGGTAGCTGGGTGATCTTTCCCTCGACCTCAGCAAAAGTCAACCGTGACACT
TGTTCAGCTGTCGGTTTTCTCTTTCACTCATGCACGCTGCTTGCACCAGATTCATCACTCCGGTAATGGACAGGAAAATCGTGCTGCATGTCCTGGTCAT
AAGCTTTACGATCAAACGTATCAGTGTGAGGTGGGTCAACACACCCCTTGTCAGGAATAGAATCCATCATTTATAAGTCTGAGCACAGACTGCTCTTTTG
ATCGGCCCTCCAATCGCTTTCCAAGCATTCATAATGATCCATCTCGCCCGCAGTCGCAATCGAGGACACTGATGAGGTCGACCAGGTCGTTCGTGCAGTT
GGCGTCGTCATGTCTTCCTTGCCGCATCTCATTGCGGGCAATCAAAGATGCAGCGCCGACCATTTATCTACAGCAGAGTTGGCGTTAACGAGGCAGCTGG
GGCGAGCGCGTCTTGGCAAGCTTCAACTCGATGCATAACTTTGGTCAGAAGTATTGCGTTGCGCATCCACCATTTGGTCAAAAAGTGAGTCCTCGACCTG
CTGGTATTGTTGACCATCCTGTTCACTGTATTCACGGTCAATGTCTCCTTGTCCATCGTCCCCGGTGTTCCACCGAGTAGTGACAGCTGCGGCTTTTAAT
CGGACAGCAAGACTAGACACATTTGACTCGATAGAAACGTCGGACATAACATCGCGTTCGAGACGTCGAGATTGCCGATTCACAGGTAGTGGACAAATAT
CAGCCTCAACGGTCTCACTTCGTTCGATCGGTCCAGTCTCTGTGTGCCGTCGTACGCGTGATGAATCAGCTGACGCATTCAAACTCTCGGCGTCTTGTCC
GCAGACGGAAGAAGTCGAGGAATTCCATCCACTGGATAGCACAAAATCCCTTTCATCAACGAAAGTCGATGCATGTTCACCAGTTGTTTTCCGAATTCCA
CTCGTAAATGCTTGACGACGTGAATGTTCAGTCGCAGCAGCCTGGTGCCCATAGTAGCTTAGACGTTGTCTACTTTTTCGTCCCGGGGACACAAGCTGCT
CAGCTGTCGATCTTCCGCTATTTTGTGCTTCGATCAGCTGATCTGCAAACTCCTCTGACCCTTCGTTACCCTCTTCGGATGAGTGCGAAACCGACGGCGA
CACGCACATAGGAAAGAACGGGACCAGTTCATTTACGAAGCTATCATCAGCGGGGTGACCAGGTTGCACTTGATCCAAGCTTTCATCAAGTAAGCTTTGT
GCATCTGAAAGTGGTAACGAGTACTGGGTGACAGACGCAGCTGAAGTACTATGCCTCCGTGCTTCATGGTACATGTCTCGGTGATGCGAGTGGTGAAGAT
AGAAAGCCACAAAAGAGTGCCCACTGTCGCTATCGAGAGGAGGACAACACGATTCAGTCTCAGAGTTTCCCTCATTCGTACTAAGGTCTTCAGACTCCGA
GAAGATCGTCATGTGTGGATCTGCAAAGCGATGACCCAGCGTCCTTGCCCTTCCATTTGCCACTTCAGATAGTCGCGACAACGATATTTGGCTGACAGTA
CCAGACGATACGGACGATAACAGCTTCCATTCTACGTCCATGGCCACATGATCCGAGTACCTCGCCCTGTCATTAACCATTTCATCGAGTCGCGATAACG
ATTTCTGGCTGACAGAACCAGATAATGCAGACAATGACAACTGCCCTTCTGCATCAAAGCTTTTTCCATCAAACTCGGTACCCTGATCGCAAACTTTCTT
TCCATACGAACTTCTCGATTTAGAGATAGCTGACCGATATTTGTCATGCTCAGCAACAGATGCATGGTCAGCTTCTTTGCAGGAAATGTTCCTTGAAGTC
ATACTTTTGTTTTCAGCAGAATGCATGGACGAGAAAACTCTACTGTGCTCCATTCTGCATCGAGGCGCTTTTTCGTCTCCTTCGCTCCTTGCTAAATGCT
GCGGTGAGACACCCGGATCATTGGATGTAGAGTGGGTTGCGGCTAACCTTGACGTGGGTAAATTTTCAGGTCGCTGTCTTGCCTTGTCGACATTATTTCG
ATACATTTCGATATCAGGCGAATGTCGATCACTTCTAGTCACGAGCTCACTCCATTGTGCATCAGGCATCTCCAGGAACGATCGATCACGAATGTCATAG
TGTTTTCCCGATTGCCCTGTATTCAACCGCAGCATTTTCTTGTGATCCTTGGAGGGAGCGACGGAAGACGCAAGGCCGTAGCGCTTTGCAGCCTCTTTTT
CTAAGCGTTCGGTCTCCACAAGTCTGTCCAATCTGTCCTCTCTCTCCTTACCTTTGAGCCTTCCATTTTCTTTAGAAATGGAGCAGCATGGGCACTGTTT
CGTGCAAGGTGCTAAGTCTTGATGATCTCTTACTAGCTTATACCTCTGCAACTGTTGTGTCTTAATCAACCCGTTACTACCATGTATACTGCAGCCCCTA
CTCACTTTTGTCTTCAAGATATCAGCCTTGTTCTTCAATTCGCTGTCTCGATACCCATCAAGCGGTTCTAAAGGTACATTGGAAGTTTCTAGTGCATCTA
TGTCACGTCTGTCTATCGACGTCACAAGTTTCTCAGTTTCTTCACATTGCAAGCTTTCCAATGTAGTCGTTATCAAGTCCCTTTCACATGCGGGGCTAGA
TCGTTCATCATGTCCACTTGTGGCCAAAACGCCAGACTTCATCTCGCCATTCATGTCAATAGAGATGCTGTGCTCAGGAGCTTCAAGCTTACCGCTGCCT
CTTGACTCACCATCTACGATCATATCGCCATTCGAACGCTTGTTTTTGGAATTAGCTAAAGTGACAGATTGAGTATCGTCCGCATCACCCCCCGCTCGT