Description :
From Genome Similarity Track
Location :
Scaffold_239:1266- 3512
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_239-snap-gene-0.17Conserved gene of unknown function

Sequence
2246 bases(100 bases per row)
CCTCAACTCAAGTACGAGTCTCTAGCCCAATCGGGAGCCGCAAATGACGCCACTTTCGCTTGGAACTCGTTGTCATTGAGCCGCTCGTTAATGTTCGTCA
CAAACTCGTAGCTCGAGAACACGGGGCCACTGTACATCACATTATCCACGACGAAGAAGCCAAAGTGCACGTCGCCGACACCGAGATGCAAGATTCCTCC
AGGATCGTTGTGCTCCACGGATGGCACGTCAGTGTGCACATCGACAACGAGCACATCTCGCTTGCCAGAGTCTTCACGATTGGTGTAGAACAACCTCGGG
TACCAACCCAGATACCTGGATCCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNCTGCCAAAGCGCTCTTCCATGACGGTCTTGATGAAATCCGTCTGCTCC
TTGTTCAGTGGCTGCTTCTGGACTTGACAATCAGCGATCTCCTTGAGCGTTTGCATCGTCGCCGCGAAATCTGAGAAAAAGTGGAGACCGTTGTACTTTA
TGCCAGAATCCTCCGAGGGTGTCGCCAGGCTTTGAACGATCTGAGCCATGCGAGTCGCTAGTTGCTGCATGGTAGCGTAGAATTGCGGATACGGATCCAC
GAAACCAGCGGCGTATTCGCATCGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGTGTAGCTCTGCTTCGCATACAAGACCGAATCGTGGCGAAGCT
GTGTGAACGACGCGAGTTGCGTATTCATCTGGCGCAATTGCCACTCGTGCGAGTGAAACACTCGCGCAGCACTCGCTGACCGCGCGGAAAGTGCTCGCAA
TGCCCGAATCCACAATGTACTGATGCTATCATCCTTCAAAGTGTCCGCAGCAAACACATCATCAATAGTTGCACGAAGCGCGAGAAGATTGGACGCGTAC
GGAACTCCATCACGGAATGGCACAAACGCCGTTGCTCCTCCTTCCGCCGTGCTGCTCATTCGCTGAGCAACCACCGACCCCGCTGCATCATTCCCAAGTA
GCGAAAATGCAACGTCAACAGCGCTTGGTAGTCGGCGCACCACCTTGGTTCGTTTGTGGACGACTTGATCGTATACGAGCCGTGAAAAGATAAACGAGCT
CCACACGAAGCGCTGACCAAAAAATGTAAAAGACGCTGGGAGCACCGTTGGAGTGGCGTCCGCCGCAGAGCTCGTCTCGGCGTNNNNNNNNNNNNNNNNN
NNNNGGTGGCCACTGATGAGCTGCGTGCCCCAACCGCTGGAGGCGAGTTGCTGCTGGAGATCGAGTAGCATTGATGCAGAATTCTCAAACCCCACGAACA
CTTCGAAGACGCTTAAACCGCTTGGCAACAACTTATCAAGCTGCAGGGGCGTGAGCGAATCAGCTCCGACGTTGCCGTCGCCCACCAAACTTGTAATGAG
CTCGTCCAACGATGAAAGTAGCTGCAGCCGATCCGATGCACGCAGCAAATGCACAAGCGTCACTGCGCATTGGAGCTGGTACAAGTCGACTTGAGCGTCT
TCTCCTCCAGCGACTCGAAAATCGATCGTGCTCAGCCACGTCATCGCCCGGAAGTATTTCATGAGCTTTTCTGTTTTCGTGTAATGACCACGTGGCTTGA
ATAGCGAGAAATCCACCTCTCGCTTGGCTCCAAACAGAGAAACACATTGCATTTCCTGGTTCTCGACTTGATTCAAGAGTGACGACACGTGTGAACTATT
TGCAGCGAGGCCGCTTGATTCTTCTCCCCCAGTCAGCAGACTCACTCCAATTGTGACGAACAAATCAACATCCAGAAGAATCTGCTTGACTTTTGTAGAT
ATTTGGTCTGACATCGTGATCCCACAAAACAGTTCGTGGCACTTTGTCTGCACGTCAGAGAGCGTCTTTAGAAGTACCGGGGTGCATTCCTCTTGCTCAA
TGTCCACGAGTGCTGCGTCAAAGCTGCGATGCCACGCATGCAAAATCGAGTCCGTCGTGATGTACACAGGCATATCGTCGGTATACAGTTGGTAGTACAC
TTCGGCAAAGCTCTCAGCAGACATGCGCTGCGACACAACAAACCCGTTCTGTGCTAATCGCTGCATCTCTGGATCCTTCAGTCGAAAATCAAATTGCCGC
TCTTTCTTCAGTTCATGGTGCTGCGACGAGCCCAATAAATTCCGTACGTACCTCTCCCCATGCGTTTTCTTTGCATCTTGGCGCGCTTGCTGCCTTTGTG
CATTGATTTCTGAAGGGTTCGCTGCAAACTCGCTGTAGAACTTGCA