Description :
From Genome Similarity Track
Location :
Scaffold_38:126599- 129261
Transcript NameFunction/comments
Phyke_g4874hypothetical protein PHYSODRAFT_338700
Phyke_g4875hypothetical protein PHYSODRAFT_549315

Sequence
2662 bases(100 bases per row)
TCAGCTATACCATCGGATGATCCTGTCAACACTGAAACTACGAGCACAGGTGTGAAAGCTGAGCATATTGAAACTAAAGTTAAAGCTGAAGATTCCGCTG
CAGATACAAATGCCGAAGCCGAACCAGACGTCAAAACTGAAGGTGGTGCCAATGCAGAAGGCATTGATGCGAATCCTCGATCAGAATCGGGAGGCGTGGA
AGCCAACGTTGATGATGGTAACTCAAGTTCCAAACCCGACTCAAGTTCCAACTCTGAGGCAGTGACCAAGTCTGAAGAAAACGGTATTACTCCGATGGTT
GACGTTTCTGCCACAGACGTCAAAGCAGAAGACAATAACTCGATTGTGAAAACGGAAAATGCTGACGAATCGGCTAAAGCTGATAGCAGCGTAATTGCTG
AAAACGCAGGtagtgcagctgcagctgcaggctCCGAAGCAGTAACCGCCGCCGAAGTTAACGGAGATGTTGACACTGATGTCACGATGGAAGATGTGGA
GGCCCAGCCTAACAGCACTGATCCAAAAGACAGCGCTAAGACAATCGAAGTGGACTCTTCGACTGACGCTACTGATGAGTCGACTCCTGTTAGTACAACC
GTTGATTCCAGTAGCATACCCGCTGCTGAGACTACGCCAAAGGAAACTGGAGTCGTGAGCACAGAGAATGGTGGGTCAGAGGCAACTTGTGCCGACGATA
AGCCGATAGAGATTGACGAACCGTCAGTGGGAAAACAGACAGAGGTCGTCGAATCTCCAGTGAATAAtcaagaggaggaaaacaTGAAGAAAGTAGAGAT
AGTGGAGACGAACGAAGGGGGCGAGCCGTAAGGTGTGATCAGACGAAATATTCAAAGCTCCTACTGTGTTCCCCATCCAGTCTGACTCCGGCCAGCAAAG
CGTCCCTCGTAGATGAGCGATAGGCGTTGcctcatcgtgctggtggtcgtAGACTGCGACAGTTGCAGTTTGGATGATAATTATGCATCAAGTGATTATA
ACGGCATCGTCACCCCGTGCTGCTTTACCAGAGCTGCAAATACAGTGCTAAATGACGCTGAAGAGTTCTCATGCGGCTTACATATGCAGTTGTAGCATAC
AGCAAACTTCTTCCCCCTATCAATGTGAACTATCGGCGTCGAGCAATCGACCACCGACGCCACCGTACAACTTGTGCCAAACTGACTGACTGGTAAAGCA
TACATTTTCAATTCAAACAACTTACAAAGAAAAGCTACCGAAGCGCTGCTAAGCGTCCATCTCGACGCCGCATTGTACGCAACACGTTGCGTTCCTCGCC
GCCTTTGCGACTTACAGACTGTacatcttgatcttgaggaaAACCGCAGATACGAGGAAACCCAGAGCGGACATGACACCACCCAGGAACACCGGGAGCT
TGTAGCCCATGGAGGTGTTGACAATAGCCGTGCCAATAGCGTAATTGAGGAGCTGGCCGAAGCAGTTGGCAGAGTTCAACGCACCCACGTACATGCCGAT
TTCGATGTCCTCGCCCATGACATGGATAATGCATGGCACGATGCAGGAGAACCATACAGAGGACGTCATGCCCGTGATAGCGACGACGAACACATCGAAG
CCCTTGTTGCTGGACCAGGCCATAGCAAGAAGGAACATCTGCGGGATGGTGGACAATGTCAACACCCACTTGAGACCGAACTTGCTCACCAGGAACGGGA
TGCACCACGAGTAGACGTAGCCCACAATGTTGTAAGCCAGATCGGCGTTACCGCCAGCAAGACTGACACCTTCATTGTAAGCAGATTGCTCCTCCGTGCA
AGGGTCGCACGTGTCGGCGTTGGCCGAGGTTCCGCCGTACACTTCAAGGCCAAAGAACTGACCCTTGTTGCCGTTGTAAGCAGTGTATCCGTActgcacg
aagaagaagcaaatACCGTAGACAATGAGCACCTTGGGCAGCGTCTTGACACCGAGGTAGACCGAGTAGAAAGCGTTCTTGACCTGGGTGAATGCAGACA
CCTGTTCCACCTTGCTGGGGTCCAGAGGAGTCTCCTTGGCGAAGATGCAGGCGACGGAGATACAGATGATCATGATGACGGATAGTGTGCCCATGAACCA
GTGCATTGATCTGTAAGCAGCACCAAATGCCTCAATGTACACAGCGATGACAATAGATCCGAGGGTCGACCAGGCCTGGCCAAGAGCAGCACCGGTCGTC
TGACGGTCACCGGCAAAGTCGGCAACCAAAAGCATCGCAGGCGTCTGCACGATGTTGACAGTGATGTCCATCCAAGCGTAGAAAATGATAGTGAATACCG
CCGTCCACTTGCGGTTAGATGTGCCATCGCCACTGTCGCCCAGGGCTTCACCGATTTCGCTAGTATAGCCCATAGCGACCCAGCAAACAACACTGAGAAC
ACCGGCGGTAATCAGGTATGGGCGACGACGACCTAGCTTTGAAGTGTTACGGTCACTGAAGACACCGATACTGGGGCCCACAATGACGCCAACAATGGGG
CCGATGAACTGTGTTGCTTGGACTGCAGAGTTCGACAACATAGTCGAAAGGTATGGGCCCAGAGCGGCCCATTGCGCCGACCAAGCCATCTGAATGGCCA
TACGGGGCATTGACACGGCCAGTAACAGCCAGATCGACGGATGCGCCAACGGCTCCTCATTG