Description :
From Genome Similarity Track
Location :
Scaffold_33:126579- 127972
Sequence
1393 bases(100 bases per row)
TGGAGACTAAAAGTTAACTGGGTAAGCCAAGAACCCGTGTTGTCTGGATGGTTGTGTTGATCCCCACACTGCAAACAAAGCCGCGAGCCAATAACTACCC
ACCGACGAACAAGTTGGGCAAGCGAGTGCCACGAAAGCCGCTTCAGCAATCACCTCGTGAAGCTGAATTCGTCTCGTCAGGTTTTTCAGGAGAAGTCCAA
TAAACGAGAGAAGGATCTATCGAGGTAAGTGGAACTTCACCGTCGATGATCGAAGAAGTGCTACCGTCGGTCATTTCTCCAAACATTCCGGAGCGCGCCA
CCTTACTTAAATCGTCCTCCATAGCTGCACCTGGGAACTTCTTCGAGAGCATCGAGTATCTGCGCATAGCGTCCAGCCCAAAATCCGCGAGCTTCGCTTG
TCCACTTGCTCCAACGAGAATATTGCTCGGCGTTGGACAAACACTTTCTTGTGGAGGTAGTCCAAACCAAGTGCTGCATCGTGCAACATTGCCCACATCT
TCCTTTTATTGTCGGCTGAACGCGCCAGAAAGCAGCCCAGATTGCCGTTGGTCGTGTCTTCATAGACGACGAAAGGCGGCGTGCTCCCATACGACCTGCC
CAGCCGGTCCACCACTACTTTTAAACAGACACAGGCCGGCAACGTCACGTCCCCTCTATTCACTTCTGCACGAACTCTCTCCATCAACGAATTGATCCGA
CCTATTGGCGCCCCGACTACTACGGTCCGCGCGTTTGACCTTTTTCGTATGACGCCGCTGGTCGCGAGGGTGCTGATACGGAGGTGCGCTTCAGCTACGC
CGACAAGATTCTACACGACTAATTCATCAATTAAAACTTTTATATCGCGGTTTGGTAGAGTCTACCTACTCGGCCCCACTTACCCGAGACTTCTTTGACG
AGTTCGGTGATTCTGTCTGTCCGGCTTCATTCGAGCGTCTTTTCTTCGAAATTGGCCCGACTTCGACAACCAAAATGAGCTTTCCGGCGCCGGATTCCCT
CGTACCACCGCCAGTAGCCTTTGCCTCCATCAGCTCCTGGAACCGTTGCACCTCGCCACTGCGCGAAATTCGGTAAAAGTCCGCGTGTTGCAAGCCAACG
TGCTCCAAATACTTAGATGCCGACATCTTGGAGACGTCTGGCTTGGGTGGGGGAGTCACCTGGCCAGTAGGCACGTTTGATTCAGCGCACGATTGCGCAT
CAGATTCCACGCCAGCCGTGCGCTCGGTTACAGACTTCTTAGCCTTGGTTATGTGGTGTTCAGACTCAGTGTAGTCGGTTGTCGATTGCTTAAGCTCCGT
GCATTTGGTCGTCTCCTTACATTCAGCCGTCTCCTCACATTCGGTCGTTGCCTTCTTCGTGAAGTATTTATCTTGCAGTTTTTGGACCGTCAC