Description :
From Genome Similarity Track
Location :
Scaffold_12:126531- 130533
Transcript NameFunction/comments
Physo_349835aspartic protease 8

Sequence
4002 bases(100 bases per row)
CGGCGAAGCTGGTGGTCTTCATGTTGGTAGTGGTGGTTGGTGATGGTGGAGGAGGAGGCTGGTGTTGCTTGTGGAAGGCAAGTTTTAAGTGAGTGGGGCC
GTAGCTTTAGAGTTTCCTCCGTTGCCGTGGCCCTGCAGGACGGCGACCGACGAAACCACACACACAAGACACAGGGTTCGGCTTTCTGACTAAAATTTGA
GACGCGAGCAACCCTAGACGAGCATTGGCATGGAGCTTCACTCGGGATGAAAATACCTGCTTTGCTCGTGTGAAAGGCGCGAGGGTTATCACTGCACAGT
ACACAGTACTTAGTAGAGACTTTGACTAAAAGATCTGCAACATCAAGTTGCACACTGGGGCCTTTTCTCTAGCTGAACCAGCAGATGGACGCGAAATAAG
TGATGTGCTCCAAGGAAACACGTGGGCTTTGAGCCCCAGGATTTGCTTACGTTCGAGCCAAAAATGTGCTCTTCATGTATTGAGAACGTCCATACATGCA
CGTATACACTGTACTGGCAACATCAAGCTCGAAGTAGTAGTGCTATTTTCTTGAATTAATTAATTCCATGTACCCGCACGTGATATGTATCGCTAAAGCC
ATCCTGCGCCTCTTACGCATCTAAGGTTACATGCTGCATGTAACATGCATTACATTGAAAGTTAATGTTAGTTCGTGGTCAATGAGTTGCGAAGATTTGC
ACAAATAACGTAACAATCCGTCATTCACGAGTAGGTTTTGCACTCGTGTAAAAATGTTAACAAGACGTCGGAAAATTTCCTGCGAGACTTCGTCTGCGTA
AGATAGATCGAGCAAAGAAAGACCATAAGATGGCCGCTTTTGCTTTTCGATTTTGGAAACCGTGGCCAACCAGCTCGCCGACTGACTGGCGCTCAGTATG
GGCTCCGCAAGCTGGTCGGCGCGCCGTCGTAGGAGTTGTAAATACAACATGAACACTTCAATACGTTAGTCTTCGATTTTTCGCTGTTAATACTATGGTA
CAATAGGACTTGCTGTCTAAGCAAGGAAGGCGCCTTACACCTTCCTACCCGGAGCGGCCGTGGCTGGCGCTCCTGTCGTGTTGGGGTTGAATCGGACTGA
CGGCGAGGACGCCAACCTGTAGTCATTCGTGGCGGGGACTCCGCCGTTCATAATTGGAACTGTGGCGGCGGTGGGGGGCGTGTAGGCCTCCACGATGTAC
ACGGAGCTCGGCTGCGTTGGTGTCTGGAGCAGGTTGCGGTCGAGACGGTCGTTCGTGTACAGACTGCGCTGCACCCGCGGCTGGTTCTGACTCTGGCGGA
GCTCCTCGATCTGGCGCAGGAGTTTGCGCCGCTTCCAGCAGTAGTATCCGTAGGCGACGAGCATGAGGACGATGATGACGATCGCCACCAGCACCACGTA
CATCCACCACTGCCAGAAGAAGCACGGCTTGCCCGAGAACGGCACGTAGCTGCTGAGCAGGCTGCTCTTGCGGTCCGAGGAGCCGACGCAGCTGCAGAAC
GAGTCCTCGGAAGTCATGGTCTCTACCGTGATGTTCTTGCTTGAGGTGACGCCGTTCGGGCAGTTGTCGGCCACCGCGAGCCCCACGCGCTCGTTCTCGC
GGTCGTGCACCGTGAAGAGTCCGTCCATGAAGACGTCGCCCAGCAGCGTGAAGCTGCCCTCGGAGATGCCGAAGACGCGGCAGGCCGATTCGCCCTGGCC
TGTCGACACCACGAGCGGGCGCCAAATGTACTCGGCTGGAATGGTGATGGTCATCTGCTGCGACTTGTCGTCGTCCACTGCGAGCGAGATCGTGAGTCCG
GGCAGCGAGTAGATGATCGAGTCGGCGTTGGTCGGGTCGCACTCGCTCGAGCAGCAGGTCGAGTCGTCGTCGAAGAAGCTGTCGCTCACGTCGGTCGTCA
CCTTCTCGACCTGCGTCTTGAGCTCCGCGATCACGGCGCTGTAGACGCTGGACGGGAACGCGATGTTGCTCGTGCCCGAGTCGATGATGGACCGCGGCGA
GTTGATGGTCTCGCAGTCCAGTCCGAGGCTCTCCCCGTTCACGCCGATGTCCGTGACGAGGACGTTGTAGTACTTCTCCTGCACCAGCGGCGTGTACACG
ATGTCGCCCTTGTGGAAGCTCTCTCCGCTGGCGCCGTGCGTGCCTCCGAGCACGAACTCGCCCGCGTACAGGTACGAGTCGTCCGCGAGCGACACGTTGC
TGAGACTCAGCGCCTGCAGCGCGCCGCACATCTGCAAACTGAAGACGTCGCTCAGGCCGTCGGCGCTCTGGACCTTGTCGAAGTAGGGCGTGGGCGGGTC
GCTCGAGGGCGACGCGATGGCCTTGTAGCCGAGCCCGACGATGCCGTCGTAGCCGGACGAGATGAAGCTGTCCTCGGCCGTGATCTCGGCGAACGGCATG
CTCTCGACCGTGCCCAGTCCCTCGCCCGAGAAGGTGTCCTCCACTACCTCGCCGCTCCACGAGCCGCTCACGTACGTGACGCTGACCGCCGTGCCCTGGT
CCACGCACGTGTCCGAGTCCGAGCACGAGTACAGGTGCTCGTTCGTGAGCGAGCAGCAATCGGCCGTGACCACGGCCGTGTTGGCCGAGCCCGTGTCCAG
CAGCAGGTTGAACGAGTCGCTGGCCGAGCTGCCCGAGCTGGACGAGTACAGCTGCGACCCGACGTTCACCTGCACGTAGTAGGCCAGGCCCGACGAGAGG
CCCCAGAGCTTCTGCTGCAGCACGTCGCCGGCCTGCGCCGTCGTCGCCAGCGACAGGCTCAGCGCCATCGGAAGTATTGCCGCCACCTGCATGTGTATGT
ATGTATGTGGGTGGGTGGGTGGGTACTGCACTGCACGCCTGGTCAACGCAGCGAGTGGCGCAAAATCCACACTGCGAGCGAGGCGCCTTGACTTGACTTG
GCGTCGACCAGCGCGAGCTCCATGTGCCCGGGATGTCCCAACAGATCCTGGCCACTTTCTGCCTGTGATGTGCCCTGCACGCCTGGAACGAAAACAGGCT
ATTTGTGGTATTTGCCGCGCAAACACGCTCGATTGTGGCGGATTGGTGCCGCAAATAGAGGAATGTGGCGATCGTCTAGCGGTGGAATATGGTGTCCACT
GGGCCACATTTAGTGGACACCTCGAGCGGGGCGTAAACGAGGCCTGCAGTCAAACGCTCACCATGTGATTGAAGTCGTCTCTATGACGTTGCGCTGCAGA
ACTCGTGCCAGCGCCGCTGGACAGGATGGCGGTCTCCGCTCGCGAGCGCCAACTTCAGTCACACCGGGGTGAGCCCCGACACACAAGCACTCAGCGGTCA
ATCGGGACTCGCGCTCTCACCCAGATGAGCAGGAACGGAGCGGAGCTCGCAAGGATGGATCGGCACTGGTGCTCGCCGCGCCGCAACCCGAGGGCGTGTG
GGACACCTCAGCGCAGTCTTCAGCCCGCGCGGCTGAAGACGAACCTGTCCGTCCCCTCTTTGGCAGTGTCCGTCATCGATGCCGTCAACGCGCTCAGCTG
CGGCGGCCGCAGTGGCGGCGCAAATCGGGGACCTTGTGTAAACGAATCTGCCATTCCGCCAGACGCACTTCAACTTCCTGTATCGAAAGTTTCGAGTTTC
GATTCGAAACTGTTGCAGCAAGTCTGTGTGGTGCACACCCCACCCCATTGTGTGTGCCACATAATTCATAATTTTTAAAGGTTGCCTAAATACGCATCTG
GTCTTAAGTTCGCGTCCATTAGGCTCGCCACTTAGACCACCCGCCGGACATCACCTCGCCTGCTTTTCATCTAGCCCCGCCCCGCCCCGCCTGCCGCCCG
CCAGCCGCCATGATGAAGAAGAGCGTGGTGAAGAACCGCGCGCCCGCGCCCATCCAGATCACGGCCGAGCAGATCCTGCTCGAGGCCAACCAGCGCAAGG
AGGAGCTCGCGCAGCCGCCGCGCCGCCGCATCACGGATGCCGCCGAGCTGGCCGAGTACCGCATGGGCAAGCGCAAGGCCTTCGAAGACGAGCTGCGCCG
CC