Description :
From Genome Similarity Track
Location :
Scaffold_510:12651- 16423
Sequence
3772 bases(100 bases per row)
TTCACACGTGCCCAGACACTGATACAAATGCAAGCTTGCTCTCACCGAATCTGCTCAGCGCCGTCCACAACTGGCAAACTAACGAGCCGACGCCGTTTCG
AAGCCTCAGCACAATCCGGACGCAAGCATCGTCAACTTGCCGCGGAGTAATGCTTATCCTCTTGTCCGACAACTGCTCGATCAGTCTCTGGGGTGCGGAT
GGCGTCTGTTTGGGAAGACTCGCAGCCAACTCATCGATGCAGCAGTCGCGTCCAAAGGGGTGGCGTGTCTCGGGAATACTGAAGAGTTCGAGCGATATTG
ACCGCCTTCGCGCAGAGGCAACTGCTGAAAATGTCAAGCTAAAGCTCGAGTCCGGCATGCCCTCTCGACCTGCTGTCACGAGCTCAGTTGCAACCGCAGG
AAACACACGAGCTCGAAGCGCGATCCTGCGCCAACTTACGCGATAGTTGAGGTTTTTGACAAACATTGGAGATGAATTTCGATACATCTCGTCAGTTCAC
TAAACTATTTCGACGCTGGTGACTGCCATGGCGTATTGGATAGCACGCCTGTCTTACAGCAGACATTCGAACCACTTCAGCGGCTTCTTGGAGCTGCTGA
ACAAACCCTCGCCGTTGTGGAAGGCCATGTCGCCGTGGTTGAGCTCCGCAGCGTAGTACGTGCTCGTGTAGTCCGCCGCAAACTTGGACGAGTCGAGGTT
CCCGATGCAGCTTGCGAATTCGACCTGTTGACAATCAATATCAGTGCAGACACAATGTGAGTGAAGTTCTGACGACCCATACACTGAATGCAAACCACTT
ACAACGCCGTCGTTCTTCGAGGTGTGGTGGGGCAAGATAAGACCGCCAAACAGGAAAGAGAGGTACTCGCTGGACAGTAACCCCGAGNNNNNNNNNNGTG
GCCGCAGCGAAGGCAGAGAGACGACCGAGCATCGTGGCTGAAGTGCTTAGCTTCGACCGAGGTCGCACCGAAATCTATGTCACCAGTGTTGCCGAGCGCG
CAAATTGGCAAGTGCCGTGGGTTGATGGTGACAGGCCGCTCATCTGGCGAGAGATGGACTTCGGCGTCTGTGAAGAACTTTGAGGCCGTGCAAGATCAAG
ATCACTCGTGCCACTTTCAATCGCCCAGACTGCTGCGCAAGAAACGGGGTTGACCATCTGCTGGCGTGGCATGACGCCACGACTATGGTACATTATGTGT
TCTCGAATATTACATTTCGAAAGTTTATTATAATACTTAGCGATCGAAACAAGAACGATTTATAGATATGATATCACTGAAGGGAGGCTTTGCGATCGTC
CTGCCTGCTCCACCAGCCATCCCATTTCTGCGCAGACACCATCGTGATTGCGAGCGGCTCACTGCGCGCTTGTTTACCAGCGGGTCTTCGTGAACCCTGC
CTGACGGCCAGGCGACGGCGTGAGTGCCTTACGTGTCGCACTGGAACCGAGGACGCCTTCAATTCTATCCTGACCTCCTGGACGATGATCCGATCTGTGG
CATTGCTTCCATTTGGCAGATCGTGAACGTTTTAACCTTTCAACTGGAAAGAATTCTGCCAACTCGCCTGCTCATGAGACATTGAGCTGTCCTAACAACT
CTGTGGAAGCAAACAACGATGTGGCAACCTCACATCCCTCACATCTGCAACTGCAACGTCAAGCCATCTGCTCCTCCCCGCGGCACTTCAACGACAATGC
CATGCGGTCGGTGACCGCCAAGGATCGACCTTGCCGTCAAGAGGTAATAGATCATTGTTCAAAGCAAAACTGGCTGATCGTTGGAACGAACAACCGAAGC
AAATGAGACGGTGGTGCCGAGTTGGCACCTCACAGCAGACATTCGAACCACTTGAGCGGCTTCTTGGCGTTACTCAAGAGCCCCTCGCCGTTGTGGAAGG
CCATGTCGCCGTGGTTGAGCTCCGCAGCGTAGAACTTGCTGGTGTAGTCGGCAGCGAATTTGGACGAGGCGAGGTTGCCGACGCAGCTTTGCAGCTCGAC
CTGTTCGCATCAAACTCCGTGAGTACCCTTTGCCACTAACAACCACAAATACCGATAACGCACCACGCCGTCGTTCGTCGAGGTGTGGTGGGGGAGGATC
AGCCCGCCAAAGTAGAAGGAGAGGTACTCGCTGGACAGTAACCCCGAGTACGTCGTGCCGCACATGCTCGCCGTCACGTACTTCGCATGAACTGCACGAG
CCGAAGCGTACAGCGCCGATTCTTCGGTCGAGCAGTACTCACCGCCATCCCACACGAGCGACCGACGAGTCGTCGTTCCAGGACACTGCCCGATCAGCGT
CGCAACGCTTGTGACGATCGCATTGCCGCTGTCACAAACTTGGTGGAGGAAGTCTGAACCCATGCTGCCCTTCAGCGGACNNNNNNNNNNCTCAGTCGCG
GAACTGTAATTGCCTCCGTCCCACACGAGCGACCGACGAGTCGTCGTTCCAGGACACTGCCCAATCAAAGTGGCGAGGTCAGACACCACACTGCTTCCAC
CATCGCACGTCTCGTGCAGGTAGTCTGAACCCATGCTGCCCTTCAGCGGACCAGCCAAGTCGACCCAGTCAACACCCGAACCGATCGAACACTTGCCAGT
AGCCACCGCTCCAGCAAGCATGTTGTTCCCCATAGAGTGAGCCACAATGATCGTGTCCTTGATCACGGTCGATCCCGACGCACCGCTCACGTTCAAAGCC
ATATCACACGCCTTCTGCTGCAACGTGTCGTTGTACCACTCGTAGTCGACCGTGTTGAGGATGGCAAAGTGGAATGACGAGCAGCACGGCGCGTGCTCTT
TGATGTCACCGAAGAACGAGTAGCTGTCGACGAGTCCGCCGTCGGCTGTGACATCCATACCATGGAAGAACAGGCACGGACGGGGAGTGCTCTTGCACGA
GCAAGTGGAACTGGCGAGACTGACGCTCTCTCGGAGCGACCGACGAGTGGTTGTTGTAGCTGGAGCGACTCCCCAAAGCAGACTGAGCGACGACAGTTCA
GCAACGGCAGTGGTGGTGCTCTCGCAGTTCTCGGGAGCAGTCGACGGCTTGACAATGCTGACCGTTTCGTTGAGGTAGTCGAACTCGATGTTCAAGTCTT
CGCCGAAGACCTTGAAGTCGCCTTCTTCGTCGATCGCCGAGCAAATAACGAAGTTCTCTCCCGCGAACTCTGTCGAGAGCCACGTGCCGTTGGCGCACGA
AATATCCTGCGTCGTGTCGACGTTAGAGACGACCTCGGCGGCGGAAAGCGACTCCAAGATCGACGACACGTTCGGCAGGATCTCTGCCGGCAAGCACGAC
GTGGCGGTTCCGGTCGCGTTCACCACCTCGTGGTAGGTGACGCCGTCGACGAGTAGGAAGTTGTGCGTGGTGTCGTCTTGCGTGATGGAGAGCTTGCCGT
CGAACGCGACCGTGGTGCTGCCGTCGCTGACGACCGGGTTGATGTACACATCAAAGTCGGTGGCTCCGTAGACTGCCATCGACTGGCGCTTGAGGTGGAA
TCCAAGCCGAACGGCAGGCAGCGCCGACTCGGCGGTCGCGATGACCGGCAGCAGCGCCGACGTGGCTATCGCTGCCATCATTACAACTCGAGGGAACATC
TTCGTCTTGGCGTCAGAGAACCGATATCGGAGGAACTTGGCGCAACGGCTAATGACGCGCTGGATGGGCACAAGACCCATTGCATTGTGACTGGTGAGGA
AGACACGGTCTGAGAACGTTGAGGATCTGCCTCGACGTGACGGCTGATGCGCACACGCAATGCTCAGCATCG