Description :
From Genome Similarity Track
Location :
Scaffold_1840:1265- 3267
Sequence
2002 bases(100 bases per row)
CCTTGGATTCCCGGCCTGGGCGACAGCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGG
CCCTGTGTCGGACCCGCAGCCGGAGCCCTCGGACGAGAGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGAC
CGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACT
CCGAGAACTCGTGGCAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTTTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGG
GGCTTCTTGCCCGAGCGGGGTACGGACGTTGAAGACACTCCGTACCCGCGCTCATCATGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCA
TGCGCTTGCTGACCATGTGGGAAAACCGAACACGAAGATCACGCTGGTCCAGGATGTGGGACATCAGCTGATCTTCATGGAGTTCCCGTAACTCTGTGGG
TGAGTACTTGAGGGACTCCACCCAAGCCCAGAATATGTCCTCACAAGAGCTCCAAGTGGGACAGTTCTCGGGCAGAACCCAGGGGTAGCCCCAAAGAGGG
TAGATACCACCCCGGTTCTCGGGCTTCTTGCGACACGTAGTGAAGTCCTTAAGAGGGATGCGGTGTGGCGCGAGAAGCGCACACCGAGCCGCCTCCAAGC
TGTCAGCAAACAACTGTTCCTTCTGAACAAGGGTACGCTCACAAACACCCCTAGAGGTGTGGCCGCCAGCAAGGCCACGAGGAGCGACAAGAAGCTCCAG
GAAGAGATCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTAAGTCGATGACAGCTCCCTGGCTGACTGGTTCCACCACCCGAACCCCCACGCAC
ACGCTGGGCAGCTTGGAAGGCCTCCTGCTGCTGGTCGAGGTCATTCGTGATCTTCCGGGGCTCAGAGATAGTACCTTTCTCTTCCTCCTCCTTCTCGTCC
TCTTCATCCGAGGAGTCGAAGAGGCCACAACGGGAGTACCGAGTCTCCCTCTCCTCGCGGAGTGGAGGATTAGAAGCCGTACGCTTCTTAGAGAGCTTGG
CGCCTTCGGCTTTAGAGGCCTTAGCACGCGCATGACCCTCGGCAAGCGAGAGACGTTTGCGAGGTTTCTCTTCCTCATCGCCACCAGTTTTGGGAGTGCT
CTTAGCCTTGACGGCCGAACACTCAGAGCGCACAGACGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACGGCACGCTGTTGTCCTTGTGCTCG
CTCGGCACTGGGCTGTGCCCTCCTGCAGAGCCCGCAGGAGCATCGCGCGTGCTCTCGGACTCGGCTTCATCCTCACTGCCAGAGTCGAACTCACTTTCAG
CGAACCGAGGGCTCGGACGATTGTCTGAAGAGGCCGAAGGCGACGGGCTGCAGCGCTTGCTTGTTCGCTTGCCCACAGCCGCGTCTCCCGAGGGACCGAT
CGCCTCGGAGGCCACCTGAGTAGCCTCCTGAAGTGCCGAGCCTTTGTCGGGTGGCTTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGAAGCCTTAGCGTGT
CTTTGCACCGGTTTTTGCAGTGCAACGAGGCATGGTAAACGGTCGAAGTGGAGACCAAGAAGAAGAGTGCACAGACCGCTGCTCGAGGCTCTAACTGTGA
AGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTTATTCTGATTGGTCGGTAAAC
CGAACCTAAGTGGGGGAGGATGTAACAGGGTACGTAGCCCTAAGTGTACCCTGGCTACATAAAGTGTGACACGTCATACTCCGGGATATTTGGTACAAGG
TG