Description :
From Genome Similarity Track
Location :
Scaffold_358:12649- 16581
Sequence
3932 bases(100 bases per row)
CACATATCCGTCATCTTCGTTGCGTTGAATGCCTTGGTCAGCGCATCTGCTAACATCATCTCCGAGCAAACAAATATAGCTCAATGATTTCTCGCCGAGT
ATATTCAGATAAGAACTTTACTCGCACGTCGATATATTTGCTTTTGCTGACGACACCTCTCCTTCGACTTGTTTAATCGAAGCTCAATTTTCCACGTACA
TTAAAATAGGCAATTTAATTGACACATCAAACTCGTTTAGCATCTCACAAATTCTCAGTAACTCATGAGCAACCTTAGATGCAGCCACAAACTATGCTTC
CATTGTTGATAACGACAATCCACCCTGTTTTTTGCAAATATAGCTCACAGCCATCCCGTTCAAAAGAATCACGCCTCCGACGGTAGTGACTTTCGATCAT
GCTTATCCGCCGCAAAATATGCATCACTGAACAAGGTTATCTCCAATAAGTTCGATTCTTTACCATGTTCTTCATTGCCAGTTTAAACGTCTTTGTTCCA
TTCAAATAGTGAGAGAGACTTTTTTCCACCTTCCAATCATACACCCGCGGCTTATGCGTCTGTCTTGTCGCATTGTGTACTGCAAAAGCGATGTCCGGTC
GCGTACAACGAGTGATCCACAGCAGCGTACCGACAAGGGCCTAAAATTCTTGATAGACTGTTTACCTCCTTCTGCGACCTGCTGGAGCAGCCCCTCGTCC
AAGGATTGCAACTCGTAGCAATCATTCATTGTTGGTACGCGCGTCGTATTTGCGTCTTCTAGTCCAAAGCCACGCAGTAAGTCGTTGATTGCTCCTTCTT
GGTCCAGTTTGTAGCCGAATCCTTTTTCATACTCATCGCATGCCTAGAAATTTGCTGGCATGGCCGAGATCCTTTATCGACGACGACTCCATACTCACGA
AGAATTGGTCCACCGCATTAGCATTAGTTCTAGTCACCAGCATGTCTTCACAGTAGACGTCTACCACCACCAAGTCGCTAATTTTTGCGCTGAAATACAC
GCAAGTGTCCGTTATGAATTAAATGAAATCGGCATCAATTAACTCCGAGTGAAGCAATCGGCTCCAAAGCCTTCCAGCCTGCTTTAAACCATACAGGATT
TTCTGCAGCCGAAGAACGAAATTCTTTGGGCTCTGCACACGGAAAGAACGCAAATTTTTTTCACCAATATTCATTCCGACCGGGACGCTTAGAAATATGT
CCAAATAATCTTCCCTATTAGCCCTCACGTAATCGTTATGAATACCACACTTCTTTGGCGGGTGCGCCCCATGTTACAGCCAGAGCCACGATCACATCTC
CATAACTACGGCAAATGTCATCAAATAGTCAACTCCGAATATCTTTTCGTTGCCACAAGCAACAAGACGTGCTTTCAGACGTGATATTTCTCCATTTGTG
TCGGTTTCTGTCTTAAAACACACTTGCTGTAAAGAACCTTGCAATCCTTGGGTCGAGGTATTATCGTCCAGACACCGTTGCTCTCGAGCGTAGTCAATTC
TTCATTAATCGCATCAATTCAACCGTCCCGCCTTGAACTCTTCGTGACCTCATTATAGCTCTGTGATTCCGAATATTTGACGTGATTTACCACTTCAGGC
ATCGTCTCCTTCTGTTCTTCAGAAATATCAGATCCTTTTGTCACAGATAGCGTGATGTGTATTGGTCTCAACCACGCCTTTTCTTCTTCTTTGGCTTGAA
AGGAGCTTGCAGTGACTCGTCAACAACTTCGCTTGGAAGATTCGTCTTTTTACACGGAGTAATTGCTGCCTCTTCAAAAGTAATCAGGTGGTCTCGTTCA
CCCGCTCCTTCTGAATGCATACGTTTATTAGATCCGCTTTCTGCCATACTGCTTTGCACAATCAGATTCTGTTCTTGGGTGAGTGCCCCGATATTCGCGA
CGTGCTGCGTCACGACGACAACATTCTCCTTTTGAAGGTATACTTATAACCTTTCGTCACGTCTCTTGTCCCTAAAATTGTACCCACTGCAACGAATTCT
TGCGCGGGTCGCGATACACGTTGCACTGCAATCCAAACACCACATCCCACGTAAATCCGGTAATTGACCTGGCAAAACTTCTATCGGCAAAGATCTGCTT
GCATTGAACCTGGTTGGGCTACGATTCAGGATGTATGTAGAATACTTTACAGCATCTCCCATTATCAATAGCAGCAAATTGCCAGCAAACACCATACATC
GTGCCATGTTCAGCACGGTACGATGCATTCGCTCGGTCTTGCCATTAGACACTTGATGACGCGCCTCGCCAACTTGGCGTGTTACTCCTTCTTGCGTACA
GAATAGATCCATATTCACGTATTCAACTCCGCAGTCTGTCCGCAACACGTGTATGAGACAATTTAATCGTTTCATAAAGGTAATTTAAAACATCCTTGAG
CTTCTTCGCCGCTTAATATTTTGTTTTCGCAAGAAAAATCGACAGTAATTAGACTTGTGGTCAATGGAGTTGACCAGGTATCGGTTACCAAGCCGATCCT
TTGGCGTCATAGGTCCTTTCAAGTCGCTTCATATTACTCCACCACTCGATCCACTGGGCATTCAAACCCGAGTCCTTCTTGAACTGCACACCCTTGTTCT
GCTTTTCTTGCGCACACGTCACGCAAATTGAACTTATTTTGTCCGTCAGCTTAATGCCCGACGCCGGGTCCTGTGCCTTACGATCAATTGTATCGTAATC
CAAATGGCCAAATTGCAAATTAAAATGCTCGAGCGAGCCCATATGATCTTCTACTTGAAGCTGCAGAACACTAGTATCTTAAATGCTTGTCAGCAACATG
CTGAAAGGGTTAGCGTGATCTGAAAACGAACGCACCGCAAGTACATTGCCCTTCATTTCCACGTCAAATACCACGTCGTCAGTAGTGCGACAAACAAGTG
CACGTCGTTCCATCTTGTAAGTCAGCGGAAAATCTTTCTTCTCAAGCATGCCATACGGCATTATGTTACGAGTGAGAGATGGGGCCAAATAAAGTTCAGT
AAGTCGCATATTATGCTACTTATATCTCCAGATTTTACGGTCAAAAGCACACTCCCCATCTTGGTCAATTTAAGCATACCACCATCAGATGGCACGCACT
CGCCCTCACAGTCTCTTGCATCTTCAAGGAGACTTTCATCACGAGGTGACGGCTGGACCCACTATTGAGAATCCACATGACTCGTTCACTTGTATCCGAA
TCATTCACATCAAGTGTAAATTTTCATTCACACCAGCTTTTCCGGTCTTGGCTCTTTTTTGAAATTTAGTGCTATATGTCCAATCTTCTGACATGAGTTA
CACTTGCGAGTGTGCTCTCGCGGCCTGTGATCACTGACGCTTGCCACGACGTCTCTACCCACCGCCTTCCCCCTTCTCATATCATTTTTCACACACTGAG
CAACATATGACAGTTCTTTTTCCTGGCGCAAGTAGTCAGTACGCGGGTGTTCATACTTATCCATAAAAGCCGTGCGCAACTCACTTGAAGCATAATGCAC
CACGTTGTACAGTACAAGTGACCTGGTGCCTCCACAAGATTCACTAACAGCTACAAAATAAAGGTAGTGCTCTGGCCATGACCTCTTCGGGTCTTTCTTA
CTTGTCAAAAACTTCTTTGACTGTGCTGGAGTTATTGTTGTCTTGAACGTCTGTTGTAGTTTCTCCATGACTTGCTCATGCGACGGATTATTGAGCCACC
ACGCCTCAAGTTGCTGATTGAAGTACCGCTCGGTTGTTCGGCTAAGATAGTGTCTCAGTAGATCTTCTTTAATCTCTTCGCTTCACTGAAAACCACATGC
GAGCTGCGCCAGGTTGACTTGTCAAAGAAAAATTCTCCCCCAGTCCAAAAAATCAGACCCAAGTCCTTGGTACAGCTCTTTCCATCGAAAACACGTATGC
CAAGCTTTCTCTGACGTGTGTCTGGTACACGA