Description :
From Genome Similarity Track
Location :
Scaffold_281:12648- 15718
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_281-fgenesh-gene-0.3Guanine nucleotide exchange factor

Sequence
3070 bases(100 bases per row)
CGACACGATCAAAGAGGGCGCTGTGGCCGTGCGCAGCCACTTCCTGGTACGCTTGTTCAGACTTGATAGTTTGTTTGTGTGCTTGCTCACTTGTTTGCTT
GACCTGCTAGTGGCGCGAGCGCTTCGTAGTGGTCCGGAAGGGCGAGGTGCTCATCTTCCGGCGGCGCGATGGCTCCATGAAGAACCGCATCGACCTGCTG
CACGCGAGCGTCAAGCTCACGTTCCACAGCGACAACGCGCATGTCACGGTCGCGCACGCGAGCAGCAGCGGCAAGGATTGCATCCTGGACTGCCACACGA
CCCAGGCGCGCGACTCGTGGCTCAGCGCGCTCGTCACGGCGCGTGGGCGTCTCGAGGTGGACACCGAGTCGGACGTGATCCTCTCGGGGGACGACAGCGA
CGACGACCTCCCACTTCTCCACGAGGAGGACGCTATTGTCCACCTGAGTGCGACGACGAACACCAAAGCTGAGCTCAATGGTGATAACGAGACCGAGGAC
GACGACGAGTACAGCGAAGCCTTGTTGGCGTTCCAGGACGTGCGCACGTCCATGATCGCGGCCCACTTGACCATGAGCACGGCCAAGGAGGACCTGTTCG
TGGCCCCCGATGCGTCACTCCAGCGCAAGCACCACCACATCCACGCGACACGCGCCGAGGAGCTCGCGCGGCTCAAGTGCATCCGGTCGATCCTGCTCTT
CATCGAGAGTGTGCCCCACGGCGGCCGCGTCATCCTGCTGCACCTCGGCGTGCTCGCCTCGGCGGGGATCAAGATCGACGACATCCTGCTGGCGCTCGGC
GAGAAGCAGCAGAGCGGGACCCCGCGGCGCTCGAGTCTCACGGCCACGACGGCAACCATCTCGATGCACAAGCTCTGCGCCGCGACCTTTGTGCGCGACA
TGATCTTCCACCCGATCTACAGCCAGCGACCCGAGGTTAAGAGTGAGCAGGTCAACGGCCTCATCGACCGCTTCTTCTCGCACTGCAGGCTGCGACGCTT
CAGCCACGACGACGAGCACATGATGATGATGAGCTCCGTGCATCCGGTCGGCCTCGGTCTCGACCTGGCCGCCACCAAGGCGCTCATGCTGGACGGCGCT
GGTGGTGGCGCTAGTGGTACGACCAGTGCGACCCGCAAGACGCAGCCACACACAGTCACCACGCTGATGAACCGCGCCGAGATGCTGCTCAAGAAGAAGC
GCCACTCATTTCCCAACATCCTCACGCCTCTGCGTGCGCGAACGGGTCTACTGGACACGGCCAAGCTCGAAGAGCTCTTGAAGAAAGGCGGCGGCGGCGG
AGTTTCTTGCAACAGCACGCCAAAGCCCAAGACTCGCTCGTCCGTCCCGACAGCAAACCCAGCCAAGGCTTCTTCTTGCCCCACAGAAGGGAGTGGTGAC
AAGGACGACGACCTGGCCATGCTGGAGAACCGCAAGACGTCCATCTCCTCGACAGACTCGGACCTGTTCCGGGACGAGAGCATCCCCGAACCGCTCCAAA
GTCTGCTGTGGCGCAACTCGTGCCAGGAAGTGGCGGAACAGATCACGCTCTTCCACCACTCGCAACTCGCGAGGCTCTGCCTCTGGGACTTTTTGCACAA
CCCGCGCGAGGCCGCCAAGGAGATCTCGGAAAGCTTCAACCGACTCGTGTGCTACCTGGTCTGGTCCGTGTTGGTTGAGGACTCCCCGAAGGACCGTGCC
GAGGTGATCGAGAGCATCATCTCGCTGGCACTCGCGGCTTGTGGCATGGCGCTCAACAATTTCCACCTCGTGATGGCCTGCGTGGGCTGCCTGGGAGACA
CGCCGCTCATGGTCTCCAGACTGCCACTCACGTGGAAGAAAGTGCGGTCCAAGTTCAAAACCCACCTGCGCGAGCTGCGCACGCTCTGCGACCACTCCGG
CGGCTTTGAAAATCTGCGCAAGCGCCAGGCCTTGCTGAGCGCCAAGTGTTGCTGCGTGCCCTTCATCGGTGTCATTGGCGTCTCGCTCGAGCGGCTCCGA
GCGACGAATTACTTTACGGATAACGATCGCAAGCAGTTGCTCGACTTTGAGAAGCTCGAGCGCCAGTACGTGACGCTCTCTGTGCTCGAGAACGGGATCC
AACGACCCTACAAGACGCTCCGGGCCGTTGAGCAGGTCCACACTTTCCTAACGACGCTGGCCATGGAGTTTGCGACACCAAGGCTGTTGCAACTGAGGTC
GCAGCAGATCCTAGCGCTTGAAAGTAATGCCTCGGGCTTAGCTTCGTCCAGGCACACATCGTTCTTGCAGCCGCCATTATCTTCCGGCTCGTCATCAGGC
TGTGCGGCAAACTCAGGACCTTCATCAGGTGAGACCGGGGACATCAGCAATGGGTCAGGCTCATTTCTGTCGTTCCGTTGCATCTGCAGCACGCTCGTGA
CTGTACCACACAGCAGCGAACGTCTCCAGATTGGGCTCGAGGCGCTCTTCGCGGACGACAGACAGCCGCTCACACGGCCGCTGCGACGGTTCTGGCTCGA
CTTCAAGACCAATGTGTGGGTGAGCGCGTGCCACTTCTGCGTCCAGGGCGCGCGCTCGTGTGTCGATGCGCTGTTTCGCGACGTGCTGGTGACCAAAGCC
ACCGAGCTGCAGCAGCTTAGCGGGCTCGACGAGAACAGTGCAGGATTCCACCAGGTCGTCTACAGTACTCTGGTGCGCCTTGTGACGCAACCGATCTTCA
CGCTCTTGTTCGCCAAGGTCAAGCACACGTTTGCGAGTGAGGACGCCAAGATGACCGCGTTCGTTGCCGAGGACCGCGACCACGAGCCATTGTTGCAGCA
CCAGCCGCAGTCGTTCCGGTGGCTGAGCACCATGCAGCAGCATAGCTACTTGTCGTCACCGTTGGAGCTCGTCGCCTGGATTTCAAGGCACACAACGAGC
GAGAGCTTAGTTGCGAATGAGCCGACAGCAATGACGAGAGCACTGCTGACACAGCTCTGCAGGAGTGACAAGCAACTTGGGGCGCACCTTTTCAGCGTTT
TGTACGCGCTGCAGCAGCTTCTGGACGTTGCACTCCTGCCACGAACACAGAGAGAAGCGATTGAACTGCT