Description :
From Genome Similarity Track
Location :
Scaffold_317:12645- 13841
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_317-snap-gene-0.13Rap guanine nucleotide exchange factor (GEF) 4

Sequence
1196 bases(100 bases per row)
TTCACAGATGACAAGGAAGCGTGTCTCCTCCCGTGTGAGAACGGTTGCACTGCGGATCCCGTGGCCTTTCATAAGCGCCAACTCGCCGAAGTGGGCGCCT
TCGGTCAGGTTGATGAGTTTTGTCTGCTGCGTGTTACCGCGAAAGTCCTTGGAGGACACGATCACGTCGACAGAGCCACTGAAAATGATGTAGAAGAGGT
CGCCAACCTCCCCCTCTTtAAACACGAACGCTCCAGCTGGCAGCGTgaGGAAGTCGGCGACAGAGCACAGCTCTCGCACGAAGGCTTTGGGCAACCCTCG
GAAGAACTTGAGggTCTGTAGATACTCGCctAGCATGtcGATGTCTACTTTCGTCCGTGTGTGCTTGCTCTTGGTCAATACATTCACGTACTCGAGCTGt
GTTTGCTGATGCAGTGTGGATCGCGGTGCCCTGACGCTGCTAGTCGGTTGTGTCAACGACGCGACGTACGCAGACGAGGtGGCACTGGCAGTGCCTGCGA
GCTGCATGCGAGAGAAaAaCTCTTGTTGGTCTTGCTTGAGCATGATGTTATAGTCTTTGCGCGTGATGCGAACGAGTTCGGCTGGCGTCTTGGCCACGAT
CGTGGCCGCACGGGGCTCATCATGCAgcAGTGCTCTCTCTCCAAAATAGTCGCCCTTGCTCAGTTCACAGACGGTGACTTCGACTTTTTCCCCGAGGATG
CGTTGGGCGACTTTGACTTCGACACAACCAGCGAACACAATGTACATTGCGTCGCCCTCGTCACCCTGTCGGAAGACAATCTCGTTGGCGTGAAACTTGA
CCAGTGCCATTCGTCGGCACAACAGGTCGAGCTCCGCTGGTTGCAGGCGTTCAAAGTCGGTCGTGATCTTGAGTTtGGTCATCTGGAaCCAtGCCTTCAG
AGCCTGCAGGTCCATCTGCGACCGGTTCTCTCCATTCTGTGCGAACGCGCGCCGACACGACTCCTCGAGAAGCAGCGTGCGGCCATACAACAGTGTCGAG
CGTGGCGTGTGACGCACGTCGAATCCGGATTCAATGCCTTTGATTACATCTTCGTTCTCACCTTCGTCTTCATCGTCACcGCcGTCTCCAAGTGGATTGG
CATTGCGCAGGACGGACGTCTTCATCCAGTGCTCCATCACGCTCGAGTGGCGAGTGTCTGGGGATAGTCGAGTGGCGCGGCGTTGTGTCGTGCTGT