Description :
From Genome Similarity Track
Location :
Scaffold_337:12644- 18441
Sequence
5797 bases(100 bases per row)
GGCATCCGCTTTGATTTCAACAGTCGGTACTTGGTCCATCTCCTTCCCATCCTGGTTTCCCATCTCTGGGCCATCTGCCGAGTCGTCGTTCGCAATATTG
AATGCGTGGGCCGCCGACGTATTGGGTTGTTAACTTTTGTTCAGCTCCTCGTTCTGCCGCTGTCTTGACATTTCGGAATTCGCACCAATCTTGCAATGAA
TACTCGGTGCCGTACTCAACACCTTCTGCGCGATGCCTGCATCCTCTGGATCAACCACCGATGTCTCGTTCGCAGATTTGGTGACACACAAGGCCGAGAC
AGCTTCGTCAAAACGGGTGACTCCATTTAATCCAGTGCTGTTGCTTGTCGCTTCCGTGGTCACCCCTGACTGGACACTAACACTCGTTGGCGTATGTACC
ACGTTTACCGGCCTCCGTAGTTCGTTTGTACACACTACCGAGGCTTCGTTCACGTTATTGCTTCCGCCATGGGTGGTCGTGTACGTGTCCAAAGGTTCTG
CGGAAGGCTGACCGTCGGCCGAATCCCCGGCTGTCACCCCAGACGCCAGACAGGCTTCTACTCGTTCACGTTCTTCCAGGATCAGTGCCCAGCGCTCTGC
ACATGTCAGACGATCACTAGAATCCACTAGCGAGTCTTGTAGAGGTCGTGCTAGCACCCCACTGGGTTCTGGATAGTTTGGTCGATCAACTGCCGAAGGC
TGAGTTGCAAGCCATTGTTCGTAAATTTCACATTCACGCTGAAAGAGCTTGCGGTCTCTACAACCTTCGTAGGCCAATACTTGCCTATCTTGGTACTTCT
TGGACTCCAGACGCACATAGCCGTCACCTCGTGGCAAATCCCCATCTGAAATCCACATTGCGATCGAGTCGTGTGCTGGTAGGTACACAGTTCGATCGGA
CACGTTGGTCAATCGAATGCTCTGAGGCCGTCCACGTCGAAACCTCGTCACTGACGGGATTAGCTTGTTCGTTCGACGAACCCACAGTACGTGTTCTTCC
AGCCCGACTTGACGCTTCGCTAGTCGATATTCTCGCCACTCGTGCGCTTGAATGTCCAAACGCTCGGGTGTTAACATGGGAGCCGTATTCTTCGCTGTCG
ATCATGTTCTTGGTCTTTATCAGCGGGATTTTGACTTCGTGCGGTAATTGCGCCGCGCCGTGGAACAGGTCCAACCGGATCCCAGCTGGGATCATAAAGT
CGGTCCCGAGTACCACGTCGACGCCTGCACTATGCGCCATTACCCACATCTCGAACTCGTACACCATCTCCCATCCGAGCGTAATCTTGACGCACGCTCG
TCGCGTCGTAGACACCTTGCCTTCGTTGATTCCTTGAATGTCAATGCGGCGTCCGTGATCAGGTACATCTCGGAGTCGCAACTTCTTGGCAAAGGCGTCA
GTGATCACACTAACGTTCGCTCCTGTGTCGAGGAGGATCCTCGCTCGCTGGTCGTTCACAGCGCCTTGCACCAGAGCTCTCATTCTGATCCGTCGGTCGA
ATTTCTTGGCCGACCACCACCCCTGTCTCTCGCCAGGGTTCAACTTCATAATCTTGGAGTGACCCTTGGGCTCGTCTCGCGCTGCACTCGAAACCACGCC
GAACGAACCCTCGCTGGTGCCCTCATCAGCATCAGCACACTCCACTCTCTCTCCAACACCTCCACCGAGGATTCTACTCCTCTCCTTTTCATTTTCCGTC
GCGTTCACACTTGTTACGTAATTATCAGGCCATTCACTCTGCCCCATGAAAGCAAAGATACACTCTGCTTCCATTGAAGGCTCGGTTAACTGTGGCAGCC
CGATAGGGACCAACCCAGTTGTAGTTGGCGGGCTGCCTAGTTTAAATGACGTTCTTGAACGACGGCCTTGAGCTCTGGCGGGAGTTCCTCCTTCGTGCCT
TTAGTGCGCACGAATTTGGCAAGGTCTTGGAAGTTGCGGAAAAGTTAGCATTGTCCAGCATCGTGGAGCTGCTTGCAGAACTTGCATCGCTTGTTACAGT
AGTGGGCGGAGTGACTCATGCCACCGCACACCGCGCATGGTCCGTACTGTGGGCGTCGGTTGTCGCGGTTGAAGTCACGTCGACCGCGTTGGTCCTGATT
GAACCCACGGTCACTACTTCGGCGATCTTGATTGAAGCCATTCTCGCGATCAGGCGTGTTTCCACGCGGTTGACGGTTGTCCGAGCGTGCGTAGGTGCCT
TCAGCAGCTGCACGGCGCTCGTTTTCGTTTGCAGCAGCGAGGTATCGGTCGTTTTCATCCAATGAGAAATCGCCATCCGTATTATCCGGCTGGAAGTCGT
TGTACTCATCTTGGACATTGTCGTAAGCGTTCGGATCTTCGTTTGAATACTCGGTGCCTCCCTGAGCAGCTTCACGACCTTCTAATTCAGCCAGTAGGTC
GTCCACCGTGGCTTCAATGAGTGTCACTCTTGGTTTGTTGCGGTTGTCATCGCGGCGACGGTCATCACGCCGGTTGTTGCGGGCGTACCCATCGTCGCGT
CGCGTATCACGACTCTTGGAGTATCGGTATTCACTGTCACGCTTGGCCATTCTCTCCTTGCCCTTGAGAACATCTTCGATGATCTCTTCGAGCTCGTGAA
TGTCGGCGACTCGAGCGTGGTAGAGACTCTCCGATAGCTTGTCATCGTCGCATGTTGCCAGGAATTGCTGTACGTGTTCTTTCGCGTCGCGACCACTCTT
CTCAAAGTGTAGACGGGCGGTCCGAGCGTAGCCATTCAGCCTGTTTATGTAGTCGCACAGATGTTCATTACGTTCCCGCTTGGCGGAGTAGTAACGCGAC
AGTGCCGTCTGCGTGAACTGCGAGCAGTAGTAGCGGATAAACGCATCGCTCAACAGCTTCCACTTGCGCTTCGTCTTCTTCGGAAGTTGACGGAACCAAT
GAATGGCTCCGTCCCGGAGACTTAGCTCAAATGGAATGCACCATTTATCGGCATCTGTGTGGGTTCCAGTCATTTCATAGACGAACCCACGGAGCCACTG
CATACAGTTCTCGCTCTTGTTGCGAGAGCCTGAGAACGGCGTGATGCGATCCAGCGGTCGGTGCGAAGACATTTCAATCCTCGGTGTTGGGTCCACGTCG
TTTCAGCGTCGCTAGCTCATTCATCTGACGCATCAACTCGAGATTGAGGATCTTCCTCGTCGAATGTACGCCCCAGAATGTCATCGTCACTGGACGAACC
ATCGCTGTCGACTTGACGACGTCCGGCACCACCTTTGGGAGCTCGCGCACTGCCTCAACGACCGAACAAACTCTCGTTACCTGCGTAAATGCGTTGCATA
CGGCTCTCCGAACGTGGCGTAACCATGTGCGAGTCTTGAAAGTACGGTGAGGCTTCGGTAGTGCCAAAGGCACCACGCTCAGCTCCACGCTTGGTCGGAG
GAGTACGAACGAGTCGTTGGGGCGTCGGCGGCAGTGGAATCTTAGACGGATTTTCATCTTGAATCATCGGTCGACTCACAGGCTGCTTTCCGGCATTGAT
GCCAACGGCGCCAAACGCCTTCCGAAGCTTCTTCTTCCATTTCTGGAGAGCAGCTCCGGCTTCATGTGGACTCCAATCCTGGAGCGACATCGTCGATGGG
TACGTCTCGTTCTCGAACCCCAGCGACAACAGTAGCGAGACTGAATCCTCGGCAACTTGACTAGTCGAAACCGAGTTGACTGGGTATTGAAGTTCCTGCG
CAAGCGCAGGCCAGTCGGCCTTTTTCTTGGGGATGGGCTTGAACAGCTGCATCCACTCATCATTCTGCATCAGTGCTTGTACGCGGTCGAAAACGCGCTT
GGCGGCTGGTGTATCACCGTTGATAGGTGGGCGAGGTGCCTTCAGCAGTGCTGAATGCTTTGCACTCGCCACCGAAGGTTTAAAACCCTCGGTCCCATCG
TCATAATCATCATAGGCCGGTTCCGGTCCCGCAACATCATCGAGCTCGTCGGCGAGGTTCCTCGAAAGGGACTTGGTCGCCCCGCTCAGCCCCGATGATA
GCGTGGCCGTCTCCGGCGTCGCTGCGCCTGGCTCTGGAGCCGGCGTCTTATCTTCGTAATCTTTATAATCGTGGGCGTCAGGACCGATGTCCGCTTCGTC
GTCGAAGCTCACTGAAAGCTCGGTGGCGGCTGCAAAGCGCGCAGCCGGGCTTAAACTCTCGTTGCGAGCCCCGCCAGACTTGGCAGGCGTAGCTGGTACC
GTCGGTTGTCCTTTCGCCATGTTTCTTGTCTTTTTCTTGTTCTTCTTCTCTTGGTAGCTCGTAAACGGGAAGGCCATACAAACAGTTCACAATGGTCACA
ATCTGTTCCCGGGTTGCGGCACCAGTTGTGGTGTTGGAAATCCCACGTGAACTCTAGCTACAGATGTAGTTAGGATGTTCCCACAACAATACGTCTACTA
GGATAGTAAACGATCGCTCGGGCGGACCTGAAGACCCCTGTTCTGCCCTTGCACTGGGACAAACTGGACCTTGTAAACTACTTATATAGGCCAACCCGTA
AAAATACGCTTCTAGTACGAGCAAAACTAGCAGGTGTTATATGGATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGG
TCACCGAGTGTTCAACACTCGGCTGGAAGAATAAAGGGATGCAATTCAAGCACTCCCAGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAACCCCCCC
CGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCTTCGCTACAGAGCTTCGAGGTCACCGACAGGCATAACACACTCAAACAAG
CTTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTAAGCTTACCCTTTCAGGTCTATTCCTAATA
AGAAGTCCTAATCAAGTATACAAATATCAAGTGAACAATGATCCGTTATGGATCTTCTTGCATGCCAAGCGTCGTCTGCACCGTCGCATGAGCATCTTTA
ACGGTCCGCGCCCTGTCCCAGACGGTGAACGTGTCTTCCAAAGGTCGCTGAGTCTTCCGCGAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGAT
GGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGTGACATATGCCCGTATCCAATACTCGTTGAACGTTCGGAG
GTAACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACCTGACCGAGGGTTCGTCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACG
GGTGATAATCCGCAGCTACGGAGAAATCACTACACCACATGACGGACGCCAACCCGTTTCGACTTGCTGCGATATTTATCCTCGGCAATCTGCTGTAGGA
AAAGCAAATGGTCGATGCACTCATCCATGGGCATGTGGCGATGAAGAATACCTTTCGCAGCCCCCCAACTTGCTTCCAATCGGCTGTTTGTGTTGTTGTC
CAAGTGAGGGATGCATCCGCGCAGGAACGTACACCACAATGGCTTACAGCTTAACCAATTGGCCTCCAGATACTCCAAAAGTTGTTGCTTACTCTTACAA
AGAGCTTGAAGGGCTCGCATATAACGATCGAATTCTCGTTCATCACCAGTCCGCACCATCATCGTAATCAAGTTCTTGGCATGTATCTTCTCAAATGCCG
TAAACGCGTAGACCTTTTTGCTGATTTCGCATTTGAGATAGTCAATGACGTGGAAATGACAAAGAATCCCATGGAGCCTCAGGTAGTTCTTCTGCTA