Description :
From Genome Similarity Track
Location :
Scaffold_3:1264351- 1265820
Sequence
1469 bases(100 bases per row)
AGGAGAATACGGCGCGAGTCGGAGGAGCACAAGGTCGTCACGCTCGCGCACTAGCTCCTCGGTCTGGCTATGGACCGGGGCAATGTCAAGCACAATGCCG
ACCAGCTTACCAGCAAAGTGCTGCTGGTAGGTCGGGTGCGCCTTCGCAGCGTCGTAGATAGCGTTGACGAACGCAGCGTCCTCCTCCATCTTGATGCTCC
CGCGCTGAGTCTCGTAGTGCAGCAGACCTACCTCGGTAGAGACCGCGCACTGAATTAGCAGATTCTTACCCTTGCTGGGCGGCAGCTTCACTATGGCGTG
CTTGCCCTTGAGCGCCCGGCCCTGCATGCGCTTGCAGTACATATTGTAGTTTGTTTCATCGTAGTGCACAATGAACGCACCTTCAGCACTGTATTTAAGC
AGATCAAGGGCGAACGGCTTGCGCTTCTGGATGTTGGCTTCTCTATTGCAAGTTGCAGACTCAACTCGCACCTACATTCATAGCATAGTGCTAGATCGAT
ACATAGGTTCCGTAATGTTAGCATACCAACATACCGGCTTGACTGTTTCCAGCTGACCGGTGAGCTTCTGGCTGATCAAAGACGTGCTCAAGTCCACGCC
GAAGTCGACCCACACCATCGTCTTCAGCTGCTCAAGTGTGAGCAAGCCGTTTGCCTCTACGTAGGCGACCAGCGCCGCCTCAATCTCTGGGGTGCACTTG
ATGTTCGCCACCCGAGAGCCGCCGCGCTGCTTCACCTCCGGGCTCCCGCTCACGACGATGCAGCGAGCAGTAGTCTGGGGGATGCCATTGTGCTTGGCGA
CAAGCTCCTAGTCCACCCCCTGTTGATGGGCGTCTAGGACGCGCGCGCGAGCTGCGAGGCTGTGCTTGGGCTCCTTAGGCATGAGCCAGTCGAGGTGAGT
TGCAAAGTGACAGCACTCTGAGTGCTGGCGCTCGAATTCTACTCTCCAGTCGTTCTCGATTGCTGGTGCGTGCGCGCGGGGTCTCCGCATCCAGTCGTAG
TCCGTTTGAACTTTAGAAATTCCGCTTTGACCTAAAACCTAAAACTTAAAAATGAGACCGCGTCAAACGAAAAGGTGCTTACGAACCTAAGTACGAATCG
CGATTTAACCGCATCAATCGAAAGAGGCATGTCTTGTGCTTCTTTTAAGCTATCGAACACTCCGAAGTATTAAGAACACGTACAGTAACATCGGTCTGAA
AAAATATCTCCATTTTCGGACCCCCGAAATCCCTGATGTTATTTTGGGCGTGTGACCTCAATATTTTTTCGATTTCGACTTATTGTATGTGATCGGAAAG
CTCATGCTAAAAGCAATCGAATAAGAGTGTTTTTAAGCGTTTTACGAGTAGTTTTCATTTTCAAGAATTTGATGTCCGGTTATGTCCGAAATTTGATTGA
TCAACTTCAAATGCGATTATCTCGAAAACTCCAAATGGTGGCTTAGCGTCTTTTTGTTTGACGCGGTCG