Description :
From Genome Similarity Track
Location :
Scaffold_193:12641- 13857
Sequence
1216 bases(100 bases per row)
AGCCCGATTCCTCCTGCTCCCCGTGGGGTGTAAAGCAGCCCTGAATTCACTTTGTGTCTGCTCCTGTCCGTGGACGTTGAATGATTTTACAAAAATTGCT
TCTGAAGGTTATGTAATTCGCTCCTGGCCGAGTGGGGCAACCGAAAGACGGCCGATGTGAATAATACTGCTGGCAGCATAATAGAATTCAACAGCAAAAT
CCGGACGGCCACACTCAAAGAGATGGTAGCTGCTGTCGCGAGGCGCTTTCTGATGTTCTGTATGCGTAAGGCCCAATTGGCACCCACCAGGGATCCTGTT
TCCCACTTGATACCCTAAGTATCGAGTCGTATCGCCATGGCAAAGCACTGGAATTCCGGCGTAGTTGGCGAGGTCCACTGCCGTATTAAGCACGATGAGA
ACACTCTTGTTCTGTTGCACCCAGAGTCCAGACAGCTCACCGAACCGGTGGACAATTTCCAAGACATAGAGGAGTTGATCTGCACGTTGAAGAAAGGCGG
TTGAGTCATCGACAAAAGCAGAGAATTTCTACTCGTGACCGGGAAATCGGGGACGCCGCAGTCCTTGAACCGTGGGCGTTGTAACAATGTGATGGCTAGA
AGTGGCGCTAACGGACAACCCTGTCGGATCCCTGTGCAAACAGGTGGGGGGTCAGATAGAATGCTACTTACTAAAAATCTCGCCGTGGTGTTGGTGTGTA
GATGTCGTACCATCGTGATAAAAGCCCCATGAAACCCAAACCGCCCGCATTACTTCGAATAAAAATGCCCGCGATACCGTATCGTATGCCTTTCGAAAAT
CAAGGAGCAAAATGGCTCTACTAGATGCTGCATCTCGCTCCGGTTCATGTACCGCCGACGTTAAATGAGCCACCATCATCACGTCAGTTTTAGACATCTG
TCTGCCATGGAAGAAACCCTGTTGTGTGTCTTGAATTGGAACTCCAATGACGTCTTGGACACGACGCGATATCACCTTAGCGACAATCTTGTAGCCTGTC
TGTAGCAAAGCGATGGGTCTGTAATCCATTGCATCCATAGAATCACGCTTCTTTCGTAGTGGGATAATTGGACCTTCCAGAAAAGAATGAGGAGGGGTCC
GGCCTTGCAAAAGCTCATTGCCAATTGTGACAAGGGCAGGTTCCAGAAGCGCTTGAAAATCTTTCAGAAAGTCGTTAATCAGTCCATCCGGGCCGGCGGC
TTTATGCCTGTCAAGC