Description :
From Genome Similarity Track
Location :
Scaffold_1341:1264- 4020
Transcript NameFunction/comments
Phymu_g13134PREDICTED: hypothetical protein

Sequence
2756 bases(100 bases per row)
TGAGCAGGTGCAGAGACTCTATCTCcgagaggaggaggctgaggcCGAAGAGGAGCCCCCGAGGGGCGGACACGCGACGGCAGCTGAGGCTGGAAGCGTG
CGCGGAAAGGAGAAacccaagaagaagcaaatCTGGCAACACGAGCGACACATGACGCGCTTGGTTGCGCAGAAGGCTGCGGAGAAAGCGGGCTAGCCCG
CGCGGCCGGGAGACATTGCGGGCGACGTGGTGAACAGCATTGGCGAAGTGGATCCGAGGAACTACGGGGAAGCCATCGGGGGTCGCGCAGGGAGGACTGG
ACGAAGGCCGtccaggaggagctggaagctctggagaaCAATGGAGTGTGGGAAGTCGTGCTGATGCCCCGAGGGGTGCACGTCCTGCACACGAAATGGG
TCTTTAAGACCAAGTTGGACGCGGACGGGTTCATCGAACGCCTCAAGGCGAGGTTAGTTGCTTGTGGAAACGAACAGCAGTTCGGCGTCGACTATGACAT
GACCTTTGCTGCAGTGATGGAGATGGGCAGCGTCAAGCTGATACTCGCACTGGCAAGGAGATGGAAGGTCCCAGCAAGGCACGGTGGTGTGCCAAACGCT
TACGTGAAGGCGGGCACGGAAGAAGATCTGCGGATCTACGTACGTATCCCGCAGGGAATAATTATCTCGCGGAAGGAACGAGAGGGTTTGGGAGCTGAGG
ACAATGAGGAGCTGGCTCTGGAGCTTAAGAAGGCTCTCTACGGACTGAAGCAGGCGGGGTGCTTATGGAACAAGTTGCCGCTCAAGAAGTTACTGGCAGC
GGGATTTGCGCAGAGCCTGACTGACATGTGTGTCTATTTCAGGTGGAGGAAAGAATCGTTGCTGGTAGTGGGCGTTTAtgtggacgacctgctggTGACT
GGAACGGAGCAAGCGGCAGTGGATGCTTTCTTTGGTGAACTCGCGGTGCTCTCGGTCAAGGATCTGGGACCTTCGAGTAAGTTCTTGGGAATGCGTGTGG
AGTACACGGATGAGAGCGGATACGATCTCGACCAGGAAATGATGATCGAGGTCATGCTGAGGTCGTACGGGTTGGAGAACGCGCACAGTGTGCGCACGCC
CATTGGGCCAGAGAGGAGCGAGCTTCAAGGCACCGACGGCAGCGCACTGCCCACAAGCGGGATGTGTGAGTGTGCAACGGTGAAGAAGTTTCAATCCCTG
GTAGGGAGTCTGATGTGGGTCTCGCGATGTACGAGACCTGACATTGCGTTCGTGGTCCACAAAGCGTCGCGGCAGACGCACGCCCCGACGGTTGGCGATT
GGAAACTGGCGGAAAGGATTCTCCGGTACCTCGCggggacgaaggagctgaagctccgGATGAGTGGTGCGCCGGCGACTGATGAGGCGGTCGAAGTAGT
TGCGTACTGTAATGCGGACTTCGCCGCAGACAGAGAAGATAGAAAGTCTGTGACGGGAGGACTTGCAGTGGTCGACGGCATGGTCGTCGGCTGGGTCTGC
AGAAAGCAGGGAGGAGTGTCGTTGTCGACTATGGAGGCGGAGTATACGGCAGCGTCCGTGACGGTCACGGAGATCCTGGGTGTTCGCGAAATTCTGAGGG
AAATGGGCGTCCGGAACAAGGACCCTATGGCATTAAGGGTCGACAACCAGgcggcgttgaagcagctaggtggagaaggagcttcagcCAAGGCGAAACA
CATTGACGAGAATCAAGTTTGTGGGCAGCATGGCTAAGAAGAGCATCGTGAACCCGGAGTGTTGCGAAGGCGAGAGGAACCCTGCGGACCTGGTGACTAA
GGCGCTCCATGCACCGAGGCTGGCGGACCTGCGAGTCATGTGTGGCTTGCACTAAGAGCTGCGAGTCTATTGTATGATGCATTTTTCAGAGGCTGAAGTC
ACCGGAAACGGTCTTAAGCGTGAGGTAAGCTTGAAGGACGCTCGGCACTGCCGGTCGAGGAGGAGTGTTGGGCGGTCCAGATGCACTGAGAGGCGGTTCG
GACCAGAGATGGGATGCGCCGGCAGGTGCGATCGCCTAGATACACAACGGTAGTTATTGTACTGGCCATTAAAGGTGGTACTAAATATTCTAACATGCAG
TCGTAATTACCTATAACTCTACTATTTTTAGACGTCTAGACATGCTCGGACCACCAAAATATAGCTTAGGCTCATGCGCTGCTCATACAGCCAGTATTAC
TGTGCGATTCTATTCAAAAGAATgggcaagggcaagaagtTGAGTGATGGCGAGAGGGCTATGATTGTGAACGCCTACAAGTTCTTCCTCAAAAGTCGGC
CTGAGGGCAACGGAGCGACCGGAAGGACACGCAGGTTAGTCAGGGAGTGTCTTGGGACCCCGAGAGCACGGTTGGGAGCGTCAGGAAGGCCTACATCGAC
CGCCAAGGCTCCGAGACTGTTGAGGTAAGATCGAATTTGATATCTTAGCGTTATATATCGGTTACCTGTATAACATAATATTTTACTATCATGAAGCAAC
CggaagagcgtcgtggcCGCCCTCAAAGTTATCAAGTCGAAGACGTAGCACCAACAATTGCCATTGAGCTTATATGGGGAAACATGAAAGGGTGGATAAG
TAGATACCCAGCAAAAAATATTGGTGAGTCGGAGGGAAAAGTAGGAAACAGCAAAGAACACATCAAGTCCGAAGACTGGTtcagaaagaagaaaatcagT
ATTTACGAGCTCTAGAGGAGGATGAGGATGACGTAGAATTAGCTGGTGAATTAGTA