Description :
From Genome Similarity Track
Location :
Scaffold_3404:1264- 2553
Sequence
1289 bases(100 bases per row)
CCTCCTCCTCCTGGTCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCAACGGATCCCCTTCCTACTCTTCTTCAT
GAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGACACTATAGAGTAATGCTCCACAGCTCCGATCTGCCTCGTCTACCCAACTGGG
TTCGTCATATCCACGCCAATACACCAGAAATTCGCGGTAAATCCGTCCGTATCGAGTTCGCTTCCCTGACCACATATCGGTGATCTTCTCGACTTCGAAC
TCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCC
GATCCGCGTATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCC
AATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCC
ACTCGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGCTCACCTGGGATCTAGCTTGCCGGT
AGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACTGGAATGGCCACTTCTAGGGTGGATTTGGGATCCCA
CCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCTAATCCCTCTGA
TCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGTACCATGCGCTCGGCCGATCCGTTAGCTTGGGGGCGATATGCCATGGTTGCCCGCT
GTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCTCCAAATCTTCGGAA
AACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCAACCCAAATCAACAAT
TCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTGGAAAGGGTAAGTAGCTGGACATCCCAGGGAC