Description :
From Genome Similarity Track
Location :
Scaffold_74:126383- 133433
Transcript NameFunction/comments
Phyci_164631conserved hypothetical protein
Phyci_232791conserved hypothetical protein
Phyci_94746succinate semialdehyde dehydrogenase putative

Sequence
7050 bases(100 bases per row)
GACGTTGCAGGGAGATCCGCGCCGCCCCGGCGACCTGCACCCGTTCGTGCGCGAGCAGGTGGATCCTGACGAGGCCCCCGGCGACTGGTACGCCTTCTTC
TCGCTCGTGCTGGGCTTCCTCGCCTTTACCATGAAGGTGCGTCCTCCCCTGGTGCAGTGGTATCAATTCCTAGTATTTAGGGCCCACTAATGCTGAACCT
CTGTTGGTTGATGCTGTGTTTCACAGTGGAAGGAGCTGGCGTGGGGCTCGCTGCTGCTGTGCGTGGGCTCGTTCACCAACATGAAGTCGCAGGACATGAA
CACAACGCAGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCACTCGTGTCCGCCTACATGGGCACCATGCGTCCAGGCATGCCCATGCCCCCGTCGGCC
CAGTCAGTCCAAGCCCCGGCCCCGTAGACGGGAGCGGTGGAGAGAATAGGAAAGTATACCCCCGCAGAGAGCAGACCCAGGCATGTGGCGTGAAGTGAAG
GTGGAGGGAGCTCCTGCTGTAAGGAATGGAAAAACCAAAAGCTGTTTGGTATCTGTGCTTGGTTGCTGTGGTCTTGGTGGTTGACTTTTGGCGGTTCAAG
TGTACCAGGTAACGACCGAGCGGTGCTATTTCCGAGGACTAACTGGCTGGCTGACTGCAGGGTGCTATGACTCCTGCAACGATTGCTGCCGGACAATGAC
AATTGGCTTCCATGATGCGCAACCTGAGACGCTCGGAGAGGAAGCTGCACGGACGAAGGACTCCTCTCCCCGTGACGATGCAGATGCGTATCAAAATGCT
AGTCGGGATGCTGCGGCTGTGCTGCCTCAGAAGCTCTTGATGAAGCGGCCACGCGGACCTCCACCAGCGACGTCGACTGCTCCAGCGCCAAGAATCCTGC
CACCAATTAGACCACCAAGTTCTGGCACCGCCGCTACAGTCTCGACGATGACGCTGGAAGAAAAGCAGCAGCGGCAGATGCATTCATTCTTGCGCAATTT
CCTCGCTGCAGGTGAGAGCGGCCGCTTCCAACAGGTGATCGACCTTCATCAGCACGGGATCGACACGGGTATTACTGTCACGGACGCGACGCTCCAGGAA
GTGGTGCTCACAGTGCCGAATTTGCGCGGTTTGAATCTTTCGGGGTGCTCGCATATAACTGACGCGGGGCTTTGGGCTGTGGCTCGACACTGCCAAGCAC
AGCTGGATACGATATACCTGGCCCAGTGCGAGAAGGTGACAGAACTTGGTCTTCGTCTTCTCGCGCACAATTGCAAATTAGTGCTGGTGGACCTCAGTGA
TTGTCCACAGCTTAATGACGCTGCACTGCAGACTCTAGCAGCAGGATGCTGGATGATCGAGACGTTCATCATGAAGCGGTGCCGGGGAGTCTCCGATGCT
GGTATCGTCAAAATCGCTCAGTGCTGCAGGGACCTACGCCACCTGGACGTTTCAGAATGCTCCCGACTCGGTGAGTACGGCGACAAAGCACTTCTTGAAA
TTGGCAAGTGCTGCCCGAAGCTGCGTGTGCTAGACCTGTTCGGCTGCCAACACGTGCATGACCCGGGTGTCCGTGCGGTTGCAAAGGGCTGCCCTTTGCT
GACGACGCTCAAGCTGACTGGGTGCCGAGATGTCAGCAGTGTCGCCATTCGCGCGTTGGCTCAGCAATGTACTCAGCTCGAGGTTTTGTCACTTTCAGGA
TGCATCAAGACAACGAATAGTGATCTACAACTGCTTGCTACGAACTGCCCGCAACTCACCTGGCTCGATATCAGTGGCAGCCCAAACATTGATGCACGCG
GCGTTCGTGCACTAGCTCAGAACTGCACGTCCCTGACGTATTTGAGCTTGGCTGGATGTCAACGCATCGGCGATGCTGCACTGAGTGAACTTACTAGCGC
CGGAGCGGGAGGACTCACCAAGTCATTAGGAGAGCTATCCCTCGCAGATTGCCCTCGTGTCACGGAGAACGGAGTCGATGCGCTAACGACTATATGCACC
AACCTTATCACTCTCAACCTCACGAATTGCAAGCAGATTGGTCGGAGATTCCTCCAACGACTAATTACGAAGCTTGAATTCGTGCAGTGGGCTACGAGTT
TCTTCGGTTATGAGCCCTTACCGAACGCCGCTGAACTTTGCCGCCAGCGTGATCTTCGATTGCTGCAGATACGAAGTGCAATCAAAATTCAGTCGGCGAT
GCGCGGGTGTCTTGCTCGTGGCGGGCTATGGCAAGCTAAACTCAAGTTTGTTGAGAGGAGAATTCTACCTAAAATCCAGGCTCGTGTGCGCGGGTTCTTA
GTCCGGAAGCGCATTGCAGCAGAAAAGAGATACAAACTGGAAGATCATGCTGCACGGTTAATCGGTCGAGCATACCGCGATCTACAGCTTCGCCGGATGC
TGGCTCGCGCAAAGCGAATTCGACAAATCAAGGAACATGAGGATGAAGCAGCTCTCATTTTCCAGAAGATATTCCGCGGCTACCGTGACCGTAAACTCGT
AGCTAGGATGCGGGACGACATTTATTATGAGCAGCAGTTCCAAGCGCGCGTGTTGGCGATGCAAAATCTGGCCGCTACGAAGTTGCAACGTGCATACAGA
GGACACCGAGGGCGGTCCGATGCTGCGATGCTGCGATCTATCAAAGAGGCAAAGCGGCTCCAACACGAGAAAGAAGTTCGTTCAGCGGCATTTATGCAGC
GTGTCTATCGGGGTCACAAGGGACGCAAACTCCGAGCTCAACGCCTTGCAGTGCTACTTCACCAGCAACAATGCCATGAAGGTGCCATCAAGATGCAAAA
AGTGTTCCGTGGCCATCGAGCACGACGGTATGCGGTGATTCTGCGCACAGAGGCAAATGAACTGCGGATACTCAACGCAGCTCTAACTATTCAAAGGTAC
TGGCGAGGCATTCGCGACAAACACTTGGCTGCTGTTCTGATAGGGCTGATCAAGCTTAGAGCTAGAGAAAACGAGGCCGCTCATTCGATCCAGGCCGCTT
ATCGAATGCATGCCTCCCGAGGATTTATGAAGGCAATGAGATTAGCTATGGCTGCACAGTTGAGACGGTTAAAGGCGGCAACAGACATTCAACGTCTCAT
ACGAGGACATCGTGGTCGAGCAGATGCAGAGCTGCGGAGGGAATTGCAGCGATTCCGCCACCAAGCCAAGCCGTTGTTCGCAAAAGAAGCACGGCTGCAA
GCGCTAGTAGATGATTTGAACGAGAAAGTGGAGCAGATGCAACGCAAACTCGCCGCAGACGAAGAAGAAGAGCGGGCTCTTACACTGGAGCTCGAGAAGA
CACTCCAGATCAAGACGAAGTATCACGACTCTAGCCGTATCACAGGAACCCCTCAACGCTATCTGACGCAGTATTTGCAAGTGCAGCTTGCTGACCAACT
ACGAGCGAAGCGCACAGAAATTGCACTTGATGGACGGGCATTCGAAACACTGACAACGAATCTGAACGATGCACAAAAGCAGTTGAGAGGTGTCAGGAGG
GAGCTGGAACCGCTAACAGAGGGCGTCATTAAGAAAACTCGCGAAAGCCGCGTGAAGAGGTTGCAGGATAAAGTTCGCCACGAGCGTCGCGCAGCGGTCA
CAATCCAAAAAATGTTCCGCGGTTTTCGCGTGAGATCAGCGGTTCGAGAGGGTGGCAATTGCTGGATTCAAATGGTTTCCCCCGACAATGGCCGACCATA
TTACTACAACGCACTGACAGGAGCCACGCGGTGGCATCGACCATTGGCGATGGACATCTTCAGCGACCAATTTGCAGAGCCTATGAAAGAATCTGTAGAG
CATATACCGTCGTCGAGACCGACCCCAACACAACTACAAAGCAGTCAGTACAGTGTCTCTGATCGGGCGAGTGTAAATGCTGACAAACACCACATTCCTC
CAAGCAATTGGTACGAAGCTTTTGATGACAAACTCCAAGCGTCATACTACTTCAACAGCCAAACTAAAGAATACCAATGGGATAAACCCGACGCTATCGA
TAATGCATACTTCACAGACAGTCAATCGTCTCGAAAACGGCGCGAGTGGCTTGAAGAACAGAAAGAAGACGTTGAAGGTCTACTAGCAGCTACACAAGTT
CGTCTGCCGATGCTAGGCCACTGGGAGAGGCGGGTCGACCCGCTGAGCGAGTATGTTTTCTTCTATCACCCGCCGACAGGAGTGATTAAGGCGTCGCTGT
CTCCACGAAGTGTACATGCCTCATTGGGAGACACCACCATGAATTCGCGCCGTTCTGCTCGCAGTATCGGCACTTCCCGCTCTCTTCATTGGCAGTATCG
ATATGGCTACGAGTACGATGCTAGCGGAAAGCTAGTCACGAGCTCTAGATCGCAACAGCGACCTATCTGGACGGAGCATACCGACCCGGACAACGGCATG
GCTTACTACTACAACGCCCTCACGAATGAATACCGGTGGGAGAAACCTGAAGACTCCGACGTAGCCTATGAGGCATTTGCAAGTGGTCTCAGCGCGAGTA
GCTCCGCTCGCAAGTGGTTTGACATGGCTCATCAAAAGGTTAACGTGGACGGCAGCAACTCGCTCACGACCCGGTCGTCAAAATCACGCGCCCTTGGTAA
GAAGTGGGTCGAGTTGGTCGACCCTGAGACGCAAAACACGTATTACTACAATGAAGTGACGGGTGAGTCGAGGTGGTCTCTTTCGCCACGCAGTGCTCGC
GACACTTCCGACACCGAAGACCAGATTTCGTTAGCCCTTTTCGCACAGGTGAAGCAGCTTCGTGAATCTGCAGTGCCTTATTCGTCACGAGACCAGCACA
TGAGCTGGCTGGAAGCAGCTATCGCCGAGAAGGACTGGAAAAAAGCTGATGCGATCGTCCAGCAGATCTTCATCCGTGAGCAGAGCCAAGCTGTGACTGA
GCGCAAAGCGAGAGAAGAAGCGGCGAGAGCAGCGAAGGAGTTTGTCAGCACCAACACCGCACAGGCCAGCACCACTGATGTGACTCCGATTGCGTGGATT
GAGTGCCGAGACGAAAACAGTGGTGCCACGTACTACTACAACCAGGTCACAGGAGAAACAAGCTGGAGCAAGCCATCAACAGCGCTCGCAGGAGGTGCGC
TAGCTAGTCAATGGGAAGCGATGCAGGATAGCGATGGGAAAACATACTACTACAACTCGATAACAGGCGAGACCGCATGGACACAACCGTGAAGCAGGAA
GGAAACTTCATTAGCCCACTGTACAAATTACTCACCACAACTTTGTGCACGCACAGCGGTGGAAACTCATGCCTCGAGTCCGCCAACGCAGACCATCTTC
GTCTCCTGGTACTCAGCAAGGCCCAGGAACGAGCCCTCACGGCCCAGTCCGGACTGCTTCACGCCGCCGAACGGAGCCTGCACGTTGGAGATCACGCCCG
TGTTCACTCCGATCATGCCGCACTCCAACGCAGAGGCCACTCGCCACGTACGCGACAGATTCTGCGAGAAGAAGTACccagcaaggccagcgtccgtgcc
gttggccatctcgatcacctcctcttccgtcgagaacttaaacagcggcacgacgggtccgaagatctcctcggaccagacacgcatggtgttatccaca
tgcgccagcaccgtggcctcatagaagttgcggccgatgtcgctgcgcttcccgcccacgagagccgtggcgccgttcgtgacggcgtcctccaccagct
ccgacgtcttgaggaaggcgttggggccaatgagcgggccgaggttcacgccttcctcgcggggcgggcccatcttgagcttcttgacgcgctccacgag
cttggcggcgaactcgtcgtagatgctggcgtggatgaagatgcggttgctgcacacgcacgtctggcccgtgttgcggaacttggaggccatgaggccg
tccagggccttgtccaggtcggcgtcctcgaacacgatgaacggcgcgttgccgccgagctcaagggacacgcgcttgaccgtctcggccgactgctcca
tcagcagcttgccgacgcgcgtggagcccgtgaacgagatcttgcgcacgtcgtggctgctggtcaGCGCGCCGCCCACCTCGGCGGCCTTGTCGTTGGG
CGACGGCACGACGTTGATGACGCCCGCGGGGATGCCCACGTCCTCGGCCAGCTTGGCGAGCGCCAGCGCCGACAGTGGCGTCTCGGCCGCGGGCTTGACG
ACGGCCGTGCAGCCGGCGGCCAGACACGGGCCCAGCTTGCGCGTGATCATGGCCAGCGGGAAGTTCCAGGGCGTGACGATGCCGCAGACGCCTACGGGCT
CCTTGATGGCCATGATCCTGTGGTCGGGCGCCGACGGGGAGGGCAGGAAGCCGCTCGAGTGCATGATCTCGTGCGCGTAGAAGTCGATGAAGCCGGCGGC
GTAGGCCACCTCGCCCTTGGCCTCGGGCAGCGGCTTGCCGCTCTCGACGGACGCGATGACGGCCAGGTCCTCCGTGTTGGCCACGATGGCGGCGTGCCAC
TTCTTGAGCAGCACGGAGCGCGCGGCGGGCGTGGTCTTGCGCCACTTCTTCTGGGCCGCGAGCGCCGCGGCGATGGCCTCGTCCGTCTCGACGCGGCCCA
TGTTGGCCACGCGCGCGACCTCCTTGTCCGTGGACGGGTCCACCACGGCGAAGTGCTTGTTGGAGTGCGCCTCGACCCACTTGCCGTTGATGAAGCCGGC
CGACTGGATCAGCTCCTTGTTGTGCACCTCGGCGTGGAAGAAGCGGCGCGTGGCCGAGGCCGCGGACGGCAGCACGGAGCGGTGGATCTTGGACGACAGC
ATGAATGGCGGGGCGGCGGCGCGGTGGACGCTTGGGCTCGACGAGGCAAGTTCGGAAGTGATTCGCAGGCGAGCAGCTCCATCGTTTTGAAGGCACGTTG
AACCTTCAAGCTGGACCGCTGGACGCGTGACTTGGAGATTGTATGGGGTACGTCAGCGGGGCCGCGTACGCTCCCATTTTGCACTTTCCGGTGCCGGTGA
CGCGCCTCGCGCCGGCCAATGGCGAGCGACCGAGCCGCGCTCGGGCGCGT