Description :
From Genome Similarity Track
Location :
Scaffold_524:12636- 15083
Transcript NameFunction/comments
g12181.t1hypothetical protein
g12182.t1hypothetical protein

Sequence
2447 bases(100 bases per row)
CCTCCTCGCGACTGGTGAGCCAGGCGACGAAGTTGCTCCCCTCCTGATGCATCCGGTTCCACCGGACGATCATTGCAGCTGCAGCGCATCGTGCGAGACA
CCCGTCAGCGACTTCCCCCGCAGCGCACGAAATCGGCGGAAGTAGCCCGTCATCTCCTCCAGGGATCCTGGAGACTTCGCTCCCGACAAATCGTACAACG
CCCAAGGCTTGAGCTCCCGGTCTATCGCGCGTGTCCGCTGGGTGAGTTCCAGCGGCGGGTCCTCCACGATCGCCGCCATAGGTGTTGCCCGCGCTATCTC
CGCTGCCGAGTTGCTCGCACGTGTTCCATCCGCAGGAGTCCCTGCGCTCGTGTCTGTCTGTCGCTCCATCTTGTCTCCGATCGCGCAATTCTGCTTGTGC
CCCTGCGGTTCGCAGAGGTTGCTGCTCGTCGCCGTTGAGACCATCCCGTTGACGCCGCGTTCTCGCCGTTTCCCAGTTTTCTTTTCTTTCAGTTTTCTTT
GCTCGCACTCACGGAGCGTGAGTGCAACCTTAAGAGGGGGGTGATGTAATGGGCCCCTCCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACA
AAGTAGGTACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGTCATCCTGCGATTGGTTGAAAGTGGGGAGCCAGACCCATTTCGACCAATCAGGTGTCAAC
CTGCATTTGAGTGGTTCACATGGATCCGAGGGCCACCCGCCCCGGTCCCAATAATAAACCAGAGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTA
TACCTGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAGCTAGTGACGGGCACTCACCTGGCCCGTTACAGATCTCAAATTGAGATGGCATCCACGGC
TCGCGCACTGAGCCAGTGCGCAAGGTCTCAACAACAGGGGATGGAGTGGACTCATCTCCATCCCGCGGAGTCGTTAAGGCTCCAGCGGCAGCGAGCGGTG
TTCCACTGCCGCTGCGCGAACGCTTCGGGCTCGAAGCGTTCGAGTCGTCCTCGCGTGGACGACGTAGGCCCACATTGGGGTCAGTGTGGCCCGGAGACAA
GGTGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCTCCCCACCCGGAGAGTAGATGCCCACACCAGTCTCG
ACAGCAATGATCTTGCATGTCTTGTTTAGGATGGCATGTTTCTCATGCCATCTCGAGTGGTACCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTG
TCGACATCGCCGTCGAGGCGATGTCAGTAGCGGTCGTGGCTGAGGCAGCGGTCGTTGTCACCATGGAGGCGACGACAGCACTTGCTGTTGCCGAAGCAGC
CGGCGTCTTAATTGAAGACGTCGTTGGCGTGCTCATTGGGAACGAGCACGTGTTATCCCGAAGAAAATACGGATTGACGTGTCGAGACCGGCACTTCAAA
TCCTAACGGGGGGGATGGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACTTTAGTGCAACACGCACTAAGGGATACATTAAGGTTGACCACTCCATA
GGTGGTCCACATTCATAACAAAGACATATGACTGGTAGAAAGCAACATTTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCGA
TGGCAGAACCTCTCATTAGAAAGATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTG
TCTTATTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACACCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGT
GGGTCTAAGCAGACCCATTACAACGACGAACAAAGGGTTCGATTTTATGTTCAACACTAGTACAGGGAGCCACAAGATCAGCAAGATACTCTGCGGTCGT
GACGTCGAAGCCAAGGTCGAGTTCCAGAACCTGAAGGTGTTCGACTCGCAGATGTGCACCAGGATTGACGCTGCTCAACATCACATCTTCTTGACATGTC
ATGACCCCCATGCTACAAGACACAGTGTCCATTAGTCGGTCCCTGATGTGCTTACCGCATGCGTGCTTCGTCACTATCCGCTGCTGAAGGCACTTAACGC
CGATGCTCCTGTAATCAAACGCATCGAAGCATGTGTACGTCACAGTGACAGCTTGGTCGCGGATCCCCTCCCATGGCCGACTCACTTGGCTTCTGCAGAG
CCGACCTGTGAAGGAAAAGACTAGGACAACAATCACGCAAGCCATCAACTCCACCAAGGAATACGAAGCGCAACAGACCATGCAACACAAAGCTATTGTC
ATTAACCTCTTAATCGAGAACGTCCAGCGCCAAGACTCACGCATGGA