Description :
From Genome Similarity Track
Location :
Scaffold_44:12636- 14083
Sequence
1447 bases(100 bases per row)
GACAAATGGCGTGCCGCCGCCCAAGACGAATTTCAGTCCCTTCACGACAACAAGACGTACGATCTTGTTCCACGCCTAAAGTCCATGACAGTCCTACCCT
GCCGATGGGTCTTCCGTATCAAGCCCAACGGCACGTACAGCACGCCTAGTTATCAAAGGTTTTCTGCAACGCGAAGGCGTTGACTACGATGACATCTTTG
CGCCTGTCGTACGCCTTGAAGTTCTCCGTTTTCTTTTCATCATGGTGGCCATCTACGACCTTGAGTGTCATCAAATGGACGTCAAGACCGCCTTTCTCAA
CGGACCGCGTCGTCTACATGGAATAGCCGCCTGGCGACCTCGTGACCGACGTCTCTCGCCGCGAACTCGTCTGTCGCCTAAAACGCAGCCTCTACGGCCT
CAAACAAGCGCCTAACCTATGGTATTGGCCCTTTGTCGACTACATGACATCCCAAAAGTACACCCGCCTACACAATGACCGCTGCGTCTTCATCAAGTCC
GACGCCTCCGGTTTCACCATTGTCAGCCTCTATGTGGACGATCTACTTATTCTTGCGCCTACTCTTCCCTCGTCCTCGCCTTGAAGGCTTCCCTCTCTCA
ACGGTTTGCCATGAAAGACCTTGGCGAAGTCTCCGACATTTTGGGATGGCAAGTCGAACGCAACCGAGCAGCCAAGACCATCTTTCTACACCAATCTCGC
TACGCCGAAGCCATCCTGGACCGCTTTGACATGGTGAACTGCAACCCAGTTTCTACGCCTTTTAACCCCAGCCTTCCATTGTGCGACGACGCCTCACTAC
TTCGCCTTTATGATCGGCAAGAACTATCGCTCTGTCGTCGGCAGCTTCATGTACTTAGCTATGGGCACTCGACCCGATCTCGCCTACACTCTCCAACAAC
CTAGTCAGTTTCTCCACAACCCTGGCCCTACTCATTGGTCTGCCGTCCAATGTGCCCTTCGTTATCTCAAAGGCACCCGCATCTATGGTATCCGCCTTGG
TGGCATCGCCTCTATCGACGATTTCCCTTTTCTCTCCGCCTACGTCGATGCGAACTATGCTATGTGTGTTGACACTCGACGGTGCATCAGTGGATTTTTT
ACTCTCTTTTTCGGCTCACCCGTGTCGTGGCTTGCCAAGAAGCAACCCCTCGTCACTCTGTCCACCACGGAAGCTGAGTTCGTTGCTCTCGCCTTATGCA
TTCAAGAACTTCTATACCTACGTCAACTCGCCCCCGAACTCCAGCAAACGTCTGATCAACCTGTCGTCGTACATAAAGACAATCAGTCTACCATCAAGAT
CGCTACCAACGCCGAACTCCACGGCCGTTCAAAGCACATCGACGTCCGCTACATGTTTGTACATGACCTTGTGGACTCCAGCGAATTCCAGCTCAAGTGG
TGCAGCTCTGGCAACCAACTTGCTGACTTCTTCACCAAACCTCTACC