Description :
From Genome Similarity Track
Location :
Scaffold_38:126351- 131604
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011869Protein of unknown function
Pytul_DAOMBR144PYU1_G011868Similar to incenp: Inner centromere protein (Xenopus tropicalis)
Pytul_DAOMBR144PYU1_G011867Protein of unknown function

Sequence
5253 bases(100 bases per row)
GACGCAAGCGGCAACGCCGTCATGGAGAAGAAGCTGCCATAAAGCACGCGCACATAGGAACACAACTACAACAACGCAACTACCATATTGGACAGCTCAT
CTGAATAAATGAATGCACACGAGCCGTCGCTAGTTCGTCAAATTCAAGGAGCAGACGATAATACATTTATACAGAAAAAGGAAACAACCAAAAGATATCT
CGCACTTTCTGAGAAATGATTATGTGCTACATGCTGTCGTTCGGTCGTGAATGGATAGTGCGTGCGTGTACGTGTACGTGTGTCGCTTGTGTGCACGCGC
ACAAATGATGATGACGGCTAAATGGAGGTTCAACAAGCATCATCGGCGGCGGGAGATGGTTTGAGCGTATTGGCATCTGTGCCTCGCATGCGCTAATTTT
AGGGCCTCTTGGTGCAGCCTATTTCCGTCCATGAGGCTATCAAAATAAATGCGCGTGCTTCGCTTCTGTTCTCGTGCAGTAGGCAGCTAGACCCGCTTCG
CAATCTCGCAAGAGCATCGAGCGCGCGGCATACAGCAGCGGGCGCGATGGCGGAGGTGAATGCGGAGGACTCGGCCGTGAGCGACTTTCTGCTCATCCTG
GAGGAGCATCGGAAGAACTGCGAGCGGCAGGGCAAGTACGTCGAGGCCGAGATCGCCAAGAACCGGTTGGAGGAGCTCAAGGTGCATGAGGAGAACCGGC
GCAAGGAGGCGATGCGGTCGCGCCAGATCGCCGAGCGCCTCGGCGTCGAGGAGGCGCATATGCTCGAGTTCCAGCAGTTCAACCACGTCTGGGACCGCAA
GATGGAGGAGTACGAGCGCAACGTCGAGGAGCTCGTCGTCGCCATGCGCGTACGACTGACTGTAGGCATCGTTCGATCAGCGTTCTGCCGTCGTTCTACT
CACGCTCGTTCTGTTCTACTGCTGCGCTTTCCAGGAGAGACACAAAGCCGAGCTGCTCGATTTCCAGCAAAAGCAGCTCGAGAAGCAGCAAAAGCCAAAG
TTCTCCAAGGACCTGCTCAACCTGCGCCGCATCGAAGAGCACCTGGCGCGGCAGAAAGAGTGCGTTTGTACTCATTGTTGCGCATGTGGACTTGTAATTC
ATCCATTGACACGCCATGCATGTATGTTTCCACGTTGCACGTGCAGCTACGCCGAGGCGCACAAGATCAAGCTCAAATCCGACGCACTGGTTCGTGTTTG
CATGTGCCAATTTTTTTGTTTGTTTGTTGCTTCTTTGTTGCTTCTTTGCGCCTCTGTGTATTCACAATGTGCATGAACTTGGTTGTCTAAATGCGCAGGA
AGCGTGGGAGCTGGAAAAGTGGCGCAACCTGAAGCAGCAGGAGATGTTTCAGCGCGAGCTGACGTTCAAGCAGCGCCAGAAGCAGGACCTCGACGCGTTG
CTCAAGCGCATCCAGTCCGGGCGCGAAGAGCAAAAGAAGCAGCGCCAAGTGGACCTCGAGCGGTAGGGCTGGCGACCATTTCGAACCCCATGCCACACGG
ATGATACCTCATAAACTGCACCTCGTTTGACTTGTGTGTCTGCAGACTACTGCAGCGGTACCAGAACGTGAAAGCGGAGCTCCAGCAGCAGCAGAATCTC
GAGCGCATTCGGTACGAAAAATTCGCGCAGCGTCCGGGCGGCGGCGGCGCCATCGTCAAGGGCAAAGCATAAAGCACAACTTTGTGCACAATGAGAAAAG
AAGAAAAAGGCCCAGCAGAAAGCCATCGTTCCTTCTACCCGCCAGCACGTACAAAACAGCGCAGAGCGCACGCGTCGAAGGGTGAAATCAACTCGTTTAA
CTTATACACAAACACGATCTTGATCATTGCCATCAATCGTCGTTCCTCATGTGCGTCGATTGTGCGCCACCACGAGTGCGCGTTGCATGGTTTTTGCCGC
TGCTTCCTCGTATCCGTCTGCTGCTCTTCACACGCACAGTCTCGTCTTGTCTGTCTTGTCGAAACCGGACGCGTGTGTCGTGTCGTGCTCCTCTTTCGCG
GCTGGTGGTACACAGCAGCTTTTTAATCGCGCCGCAGGGACTTGAAGGCCTTGCGGTTTTGCAACACCATGTACACCATCGGCAGGATCACGCCCGCGAG
CAGGATCACGAAGCCGCTCACGTATGCGCCCGAAAAGTATGAGATCTCTGCCATCTTGAATTATTGTTGTCTGTGGCCAAATGGGGGTTGTTCATCTCCC
GTAACACAGTACAGGGATCGACTACTTATAGACGACATGATGCGAGTCAATCAAACCAACGTTTGATTAAATGATGCCGAGACAAACCAACGTTCTATTG
AGTGTGTGGAGCTCCGTATCAAACAAAAGAAAATGAAAATGGTGCGCAGCAGCAGCATCGTCGGCGCCGCGCGGCGCATGGCGCGTCGCCCGCAGTCCAA
TGGGATGCGTGGTCCATGCACGCAGCAGCAGTTCTCCACGGCGTCCACGTCCGCTAGCGCGTCTGCGGGGCCGCCGTTCAAGCGCTACTTCCTGTACACG
ACGGCGATCATGTTCGGTATCCCTGGCGCGATCGGCGCCGTGTTCGTGCACAACCTCAAGACCGACGACGAGTTCTACAACCACTTCAACGACCGGTACC
CGGACCTAATCCAGGCGATCCACCAGTACTACCCGCTCGACGATTCCACGAAGGAGCTCTCGGAGCGTACCGACATTGGGCCCGTGACGCCCACGAGCGA
GCTGCTTGAAGAAAGTGCGTGGATCCATAGCTCTAACTCTAGTTGTCTATCTACATGGGTGACTTATATGATATGTGTATATGCGAATGCAGCGATGACA
GTGGTGGCGGTGCTACGCTCGAACAAGCGCGTGCGGTTCCAGGTCAAGGGAGACGCGAGCGAAGAGGAGATTGAGAAGCTCGCGCTGAGCCACTCGTCGA
CGCCGAACGACCGTGTCGTGTCCATCACGTTTGACGAAGACGCCGATCCAGAGTCGCTCGGCAGCAGCGGCGTGCTCGTGGAAGAGAACTTTGGTGCAGC
GCCGCCGCGAGCGGCCCGAGCGGCCCCATCCCAGGGTGGCGTCGTGCCGCAGCAGCGACCTGGTGTGGGCTGGAAGAGTGCGCCCAAGCCCGCGAACAAG
ACCCCAGCCCAGATCGAGGCCGAAATCGAGGCGATCGACGTGCGGCAGGCGGCGCTCGAGGAGTCCAAGTACGCTGGACGCGACGTGGACGAAGCGGACG
ACGAGATCCGCGTGCTCGAGGCGCAGAAGCAGGAGCTCAAGAAGCTGCTGCCGCGCAAGCGCTTCCTGTGGATTTTCTAGAAAGAAAACGCACATGCGGA
GTATGGATCGACAGAACGGATGGATGGACACCAGCAGCAGAGATATCATCAATAGAGCGTCCAGTGGGCAAATGTGGCAGCTGTGCTTCTGGAGAGATTC
GACGGGTGCTCTACCCGTTCTACCCGTTCTACCTGTTCTACTCGCGTTCTACCATAGGTAGTACGGTTCGCAAGCAGCCTTTGGGTTGAAGGAATTTGTC
GAGCGTCTTCTGTCTTATCCAACAAGCTGCTCCTGTTTTGTTGTTGTGTGTGTGTACATGCAGACTGGCGAAGCGCAAGCATTTCTTGACGACATCATGC
AAGTGTGTATTTACAGCAAACGCATCTTGCATTTTCTTAGCAAGGCAGAGACGGCATTCACGAAGCGTGAGTAATGCTTGCACTACTGTAGCAGCTTGCG
GGTAGAACGGAGGTGCTCTGCATGCTACTTTTCGCGAGTAGAGGAGCCGTAGAGCGCACTCTACTCTCGGTGCCATAGAGAACGCTTCTCGCGCTGGCGC
CAGTGTTGGAAAGAACAGCCACACACACACACACAGAAAGCTTCTACTCTACCAGTAGAGTGTTTTCGTTCTCTTCGCTCTACTCAACAGTTCAATTGTG
GTAGTACGGAACATGCCAGCAAATGCGTCTCTGCCGCAAGAGACAGACAAGGCAAGAAACCTCATTTGAGCGACAACAATTGCACAATGTGTGCAGCATA
CTTCAACTGCGTATGGACGCCCAAATAGACAAACAAGCGAGCAAACCACTTGCAGTGAAAGGGTGCAAGTGTGCGTGAGGAAGACCAAGAGAAAAAAATA
ACAACAACACACAAATCATGTGCAAAAGATATGTTTTTGGTGGGGTCTCTTTCTACTGTACAAATGATGTGGATTACATGTTTGCAGCAAACATTTTGGC
TTTGCGCAAGAGTGTTTGTATAGTTGCCGTGAGGAAATGTACAGCTCAGCAAGTGCAGTCTGCATTTCCATTTGCAGCACAACGTGAAAGGCAACAAACA
AATCATGCACCCACACACGCAGCTGCAGGATGCGTTTATGAATACAAAAACGGCAAAATTAAGAATGCTGCGTGTAAAGAGCACTAGGTACAACGTTTGC
TGCGGCATGTCCGCATCACTCTCATTGTTGCACAATCGCACCTGACGCCAAAATTTGTTTGTTTTGCGCAAATCCGTTAAAATTTGTATGATTTGATTGC
ACGGCAGTCACAATTGTTCGTAAAAGATAACGGAAACCTGCACGTTCCACCACTGCGTTCACATTAGCAAGGGAAAAAAAAATGCAAGGCCCAAAACAGA
AAAAAAAAAAAAAAAAAGCGTATTTATTTATCACATGAACACATTAAGCTGCTGTTTTTATTTTGCCAATCAAGGCAAAAACATATCCAAATGAAAAAGA
ACAAAAGGTTCAACTTGTCTGGTTTGCACTCGCTATCTATCTCAGTACGTTGAGGCTTCAACTGGGTTATCTTTTCCGTTTCAAAATCCGACGCAAGTGA
GACTCTGGGGGAGAGGATGTGTTTTGTGGCTTTGTTTTTGGGTTTTTCGCAGATCTGCAGCTCCAGTTCCCTCCACTCGCTTTCCCCCTTCTCTATTACG
CTCGAGTGTGGCGGCGGCGGTGGATCCGTTTTGCCGTTGGGGGTTTAAAGTGCAGAATTAATATCGACCAGAGGAGAGCATGGGCTGTTGTTGCATGATG
ATGATGATGATGATGGTTGAGAACAGAAGGCACTCGCTCTCTCCCGCCTGACTGGAATCTTTCCTGCTCCTCAATTTCCATGTGGCGCACGCATCCAACC
TGAGGAACGCAGCATGGGAAGATGCAATACTGAGAGTAATACTAAGAGCCCTTGCCAGTAAAGATACTTTTCTTTTTCTGTTGATACTGGTTTGGGCTCA
CTTGATGCCTTTTCACACAGGGATGGCAGTCTCTTAGTCTTGCTCAGCGGATC