Description :
From Genome Similarity Track
Location :
Scaffold_107:126346- 129486
Transcript NameFunction/comments
Hyaar_Emoy2809688Major Facilitator Superfamily (MFS)
Hyaar_Emoy2809689transporter belonging to the MFS superfamily

Sequence
3140 bases(100 bases per row)
GTCTGAAAACTTACTAGTGCTCGGCAGTCAACAGCGCTTCGCTATCAAGCGCATCCTCGTCCAGCATCAGCGGCACTTGATTTTTGATCGCTTTCGTACG
ATTCAGAATGTGCCCGTTCTGGTAGTCCACCACGTTGAGGGCGATGCCAACGAGACTACCCAGCACTCCAAACGATACAAAGAGCAGCTCCACATTCGGG
ATGTAATGGCCGTCGTGATTGAACTGAGCTGCGACGGCAAGAGGAAACAGTGCGAGTCCAACGTTCTGGATAAACATGCAAGGAAACAGGCGTAAGCGTC
ATAATTAAGTCCGCTTGCAACTCTCAATTTTAAGAAGGAAAAGGTGAGGTCACCAATCACCATCTCACATACCTGGATAGCGGTTATTGCTCCGTATGCC
GTTCCAACGTGCTTTGCTTCGACTACGTCTGTGTGGTGACAAGAAGACACCGACCGATCCTCACGATTAGTGCCAATGTAAAGGTAATATACAAGCAAAA
GCTTCGCTTACATGGAACAGAGGGCCACAATGCTGCGGCAAACACGCTGTAGGCTACACCCTGCAGCACCAGCGGGACGTAAAGTGTTACTTGGGTATAT
CCAAGCATGGCGTGGACTGCCGTCAATGCGAGAGGGGCTATCAGCGCTAACAAGGCGCGGAGACCAACACGGTCAACCACGAACCCCAGAAACGGAGATA
TGACAGCGCTGATAATGTATGGAATTGACATCGGGGTAGCAGCTCTCTGCGCCGCTCCCATCTTTGCGGCACAGTACGTCTTCGTCAACGGGCCGAATTT
CCATGCCTCGTCGTCACAATTGATCTTGTCGCCAAGAATGAGCGGTGGCGACGTCGAGCAGTTCCACTGGTCGAACGGTTCCTCAATCGTGCAATTTGCT
GATAGCAAGGGTAGAGGCCATCCGTAAGGAGGAACACTGGGGCATCCTGGGGCTATGTGCTCGCAATCGAGTTCGAAAATGTACTGTCCCTCACCGCATC
GTCGGCACTGCTCAGATGGTTCCTTAAAGAAGTCGCGTTCCATCAGCAGGCTACTAGCGACGTTGTTAAAAGGAATTACGCAGCCGTACACCACTAAGCA
GCTCAAGGCCAGGAACCAGAACGCTGGTCGGAAATGCTTGACATCACTGATATGAATGCTCTCTGCAATAGCCGCATCCCCTTTGTGACTCTTTTTTTCC
AGTTTTTCAGCCGTTCGATCAATTGGAGTCAACAGCAGTAATGTGGAGGTGGATCCGAGACACATGATGACACCCACCCACAGCGCTGACGACACACCCG
AAGCTTGAGCGACGACCGGACTGAGTTCGTTGTTGATGACACTGCCGAGCCGAGCCACGCTAAGGTTGATACCTAAGGCCAGTGCTAGCTCACTGTTTTT
GAACCACGAGGCAACAAGAGTTCCTTGAGCAACTCCTAAGCTCTCCCCACCGAAGCCAAAGATCACTCGGCCAAACTGCGAGAAACAACCGCACACGCCA
TTAGTCGCCACATTTTTAACAGAAAGTGGACCGCCACTTGACTCACCAGCATCATGTTGAAACTCGAGAGCGAACAGCCCGCTGCAAAGATCACTTGTCC
CGTTAAAATTGCCGTCGAGAAGGCGAAGAGCATCACGCGAGCACCGAATCGGTCCACCAAGACACCACCGAAGAATGGGAGCAAGATATTGGGGATCGAG
TACAATGTGTACAGTAAGTTCTTCAAGAATAGCAAGTGGACAGTCAGTATCAGCTAATGTTGAGTAATATGATACTTCTGATCACGGTAGTTCCTTACAA
AGAGGAACTCGTAGCGGTCTTTCGGGATGGCGCTAAAGTGCTGCTGTAGCTGACTCTTCAACGCTGCGGGGTTGTCAAAGCAGTAGTAGTTGCCGATCAT
GAGCAAGCAGGACAGAAACAGCACGAGCCACCGCACCCGCAGCTCGCTCTTCTCCATGTCGAAAATGTGTTTGACAGGTACAAAAGAGCCTTCTTGCACA
TCAGAAAATCCTCTGTATTCAAGTAAGTACGAATTAAAAAGTAGCAGCTCGAAATTCCAAATCGACCATCTCTCTTCGCGCGACTTCTAATTTTTAGGTT
CTACTGAAGCACGTATTTTCTTTCGAGCGCTAGGCCGATTCTGTTATCATCGATCGATACTGAAGCCTTTGACTGATACACTGCGCCGATTGAGCAGATG
CCATTGACATTCCGAGTTCCAAAGAAGCCGCACACGTAACTTGTATCGTTCTTTGGACCAGCGAGAGAAGTAAACGAGTCTGAGTTGGTACTGCCAAACC
ACTGAGTAGTACGCATCGTAGTTTTAAAGCGGAGTCCACGTAGAGCTGCATCTGAGTGACGAACATCAACGTGCCGGATCTTCTCGTCTGTAACAAGTTC
GATTAGGTGCTCGTTCGGCCAAGAGAACATCGCGGTCCCTTAGGTATCGGATGAACTGCTCGCTTGTGACAATGGAGATTGCTTGTAAGTGATCATCAGA
CTTTGTGACGATCGCCCGAAGTTTGTCGTGGCTATAGTAGAATGACGCAGAATCGACACCGGCAGTCGGAATAGGAATACTCTCAGTCTTTGTCGATTTG
TCAACAGCAGTCCCAGCAAACTGGCCATGATATAATGAGGGGGACGTTTCGCGATTCACCTGAGTGCGGTACTGGCTGGTTTTTCTTTGGCTGTTAAAGA
ACGGTATGGGGTCGATTCGGGACGATCGGGTGAGGGGCTCAAATGTGCAGCCCACCTGGTAGCAGCGTTCTCTAATTTGAGACCCAAACAAACTCGAAAT
GCAGTATCCTTGTGGAGCTCTTATCTCGTCCAGCTGGCTAAGTTTGCTCTGTTGCCACTCGCATTGCCCGCTGCCAATCCACTGCGAAGATCTCAAGCTA
GTCCGTATCTTTAATGATACAAGCACCTCATCCGAGAGTCGAGCGTTAAGACGCTCGATGTACTCGCCTTCCATCAGGACAAACGTGTGTTGTTGTCCGC
GAGAACATACACACGATGGATCTAAATCGCAGCGGAAAATACGTCTGACTACAATAATAGCCTCGGCCGCATCAATGACCACTGCACCCAAATCGTACAC
CTCATTTTGCCATCGGTGACCAAACTCAACTTGGCCCGCA