Description :
From Genome Similarity Track
Location :
Scaffold_74:126328- 132111
Sequence
5783 bases(100 bases per row)
TCATATGCCTGGACCACATTCGGAACGTCACGAAGGCGATTGACACGAGGCTCCCACGTACCCTCGTCGGGAGGAAACCCGAGCCATCGTACCCGATAGC
TACGGTCGGCCAGAACATCGTGGGCTCGCCCACGATGACGTTTGGGAGCGCAAAGTGGATCTTCGTGGGCAACGATGTGCTCAACAATCCAGCGGGTATC
TCCGGCAGCGTCAACAACAGGAGGAGGGCCGTCGCGTCGATTACACTCGCGTTCTGGCTGCCCAGAACTTGAACGACTTGCTGAACCGCTACTGGGATGC
CCAGCAGGAGTTGGATGAGGCTCTCGATCAGACTGCCCGGGCCACCGGGGAGAGTGCGCAGCAGCGTCAGTCGAACCGAGAGATCCTTGCTCGGTTGCGG
ATGCTGGAGAGGTCGGTTCACGGTCGTTTACAGACGGGGACACAGCCTCGAGATCCGACTCCTGGTGCGGATAGGTTGATGGCTCGCCGCGCCCGTCGAG
AAGGTCGCTCGACGCATGCTCCGGCTCAGTAGCCTGAGACGACTCTGGAATCGTAGCGGGTGATACTTCTTGAGGCGTCCGACGTAAAACGTCGGATGCG
GACGTAGTGACGTAGGGTAGGAATGGCAAGCGTGTAAGCATCACCAATGGTCTTGATTACCGTAAACGGCCCAATAAAGCGCGGTGCAAGTTTGTTCGCG
CCGAGGTTGGTAACCGCAGAGTTTCTGGTACCTTCAGTCGACAGGAGCACGCGTTCGCCTGTCGTAAACGTGGCTGTGTTCTTGCGGCCAGTCCTAATGG
CGTTCTCCTTCTGCTTGTCCACTGCATCCTGCAGTGCGTCTCGAACATAGCGGGTGACCGCTTGGCGCTGTAGTACAAAGTCGGAGACGACTACACAGTC
GATTGATCGCGCCGTATGCTTCGGCGCGTAGTTTGCCGGCGCAAGTGGGCTCGATGCGGAGCGTGTCACTGTGTTGACCGACGTGGGAACGGGAAATACA
CTCGAGATATCATTAGCAACCGGTGTAAGTACCGGTTGACCCAGTACCGGTGTTGCCGCCGGAGACGGCGGAGCTGGAGTAGACGGTTTGTCGGCAGCTT
CTTCCCCACCCAGAGTGGAGACACACGGCGCTGTGGGATAGCCCACGGCGAGGGGAGCAGGGACACGCGGGTGTCGCGCGCTGTTAATGAAGAAGGGCGT
CTTATTAGTCGACGCGTGTACCGCGTTGTTCAGCGCGAACTCGGCCAGAGGCAGAAACGAGCTCCATCTCGAAAACGACGTCGCGTAGCTTCGAAGAACG
TCTTCGAGGACGCAATTTACGCGCTCCGTCTGGCCATCCGAAGCTCTTCGAGCCCCGTAGCTCGAAGAGCTTCGACCAGAAGGCCGACGTGAAGCGCGGG
TCGCGGTCGGAGACGATGGATTCAGGAAGGCCATGATGGCGGAAGACTGCATCGATGAAGTGCACCGCGGTATCTGCCGCGGTGATCGAATCCGACACTG
GAATCAGGTGGACCATATTGCTGAAGCGGGCTACGAACCCTAAGACACCTGAGCGTCGGTTAACATCGGGTGGGAGCCCGAAGTGAATTCCATCGACACC
GAGCGCCAGGCGTCGGCGGCCACTGGTAGAGGAAAGGGGGACTGCGAAGACGAGGCCGGTTTCACGTGCTAACAGATCTCGCAGGTGCGCACCCACTTAC
ACACCCATTTATACAGGTGGGGCCAATAAAAGTCGCGTGACACAGTGGCAAACGTCTTCTCGTGACCGAGATGAACGCCCAGCGAAGCATCGGGAAACTC
TTGGATAATCCGTGAGCGCAGATCGGGGTCGTTAGGGACAACGACACGTGGGGCATCGAAGTTGTCGATGCTGTACGTCAGCAGCTCGTCCTTGAGACGA
TATCAGTGGATTTTGTTTCGTACAGAGTGGGAAAGGTCTCCCAGTGTGTCGGCGCTGGGAGAGCGGAGATGTTCCAGGATACTGGAGTACATCGAGTCAT
GCTCGTAAGCAGCTCGGATCTCGTCGCGAAGTGCTATTACCGGGGAGACGCTAGTCAGGCTGACTCCTGACGCCTCGCACGTGGCACACTCGTCTACATC
GTCTTCATCCAGCGAAGCTTGTCGACCCAATGCACCGCGTGGGTCGTAGTCGGGACGCCGAGACAAAGTGAGGGCGAGAATGTTGTTCTTGCCGGGATTG
TAACGGACAACGAAGTTGTACTCCGAGAAGAAGGAAAGCCAGCGGGCCATCCGCCGGGAGAGATGAGGACTCTTCATCGCTGTCCTCAGCGATGCATGAT
CGGTGTACACCGCGAAGGTATCCTCACCTAACAAGTACAATCTGAACTTGATCAGAGCGTAGCGCATCGCAAGGAGCTCCTTGTCGTGAAGAGGGTAGTT
GCGCTCCGCCGGCTTCATCTGCCTGGACTGGTAGCTTAAGACACGCTCTTGACCTTCTTCATCGAATTGCATCAGCGCACAGCCGATGGCGAAATCGCTC
GCGTCGCAGACGACGTGAAAAGGCTTCGAGTCATCCGGGAGCGCGAGGATTGGGGCCTCGGCGAGACTCTTCTTCACCGAGTCGAAGGCGGCTTGATGTG
CGGAAGTCCACGACCACGACACATCTTTCTTCAACAACGAAGAGAGCGGCTGGATCAATCCGGCGTAATTCTTCGTGTACTTGTGGAGATAATTTGCGAG
ACCCAGCCACTGACGCAGTTCAGTGGGATTCTGTACGCACATATCGACGACACTTTCTCGGGGTCGGCGCGGACGCCGTTCTTGCTCACAAAGCAGCCAA
GCACCGGAATCTCCGGCGCGCAGAATATGCACTTCTTTAAGTTGGCATACAGCTTGTTTTCGCGCATCACTTGGAAGACTTGCCTCAGATGCTTCAAGTG
GGCTTCAAGCGCGCTGAGATCTCCCTCAGCGGGACTGTGTACGAAGATGTCGTCGAAGTAACTCGGTGCGAAATCGCGGAGCAGGCGCAGCACATGGGAT
ACCATGCGATTGAACGTGGCGGGAGCATTCTTCAAGCCTTGTGGATAACAAGCCACTCCCAGAGCATACCACTGGGAGTGCTTACCGCTGTGAGCGGTAT
GTCGCTCAGCCTCATGAGGATTTGGTAGAGCCCATCGGTCAAGTCGATGGCGCTGAAGACCTCACTACCCGACATTGCGTCGAGCACCATGTCCTTCCGA
GGGATCGGCGTCTGGGCAGGGATGGTAGCGTCGTTCAGCTTGTTGAAGGCATAGGCGATGCGCCATCCACCCGTGGCTTTCTTCACACAGAAGGTCGGAC
TGGAGTGTGGCGATGTGCTCTCACGCACATGATCCGCCTTGCGGCGGCTCTCGAAAAAGTCATCGATAGCTTGGACCTGATCTCGCGGGAGCGGCCACTG
CCGCGTCACGCAATACTTCGAGCCGAGCACGAGATCGATCTCGTGGCGAATCCCTCGGTCAGCAGGTAGCTCAGCTGGGATCTTATCCGGAAAGACATCT
TCATATTCGCGGGCGGACTCGTAGACTGGATTGCCGGATTCGCGTAGCGCTTCCCAAGACCGCGCTGCGAAACGCTCCTCGCGGGCCGACTTCGGTTCAG
CGCTCTTTGGACGCGAGACGTCGTCACTGACTGCATTCACTTCGAGCGACGCCGAATCGCCGTCGGTGATCAGGCAAACCTGTTCGATTTCATCGGCCTT
GAGGCCGCAAAGATAGTTCTTCCAGGAGAGACCTTGAAGTCGAGTGATCGACCCTGCCTTGCTAGGCGGGTTTGCAAGCTCGAGTGTTCGTCGGGGGGTA
CCTTCCACATACTCAAGCACGCAGACCGACTCCGTCGGTGAGCTGTCACTTGGTACGGGATCTCGGTGAGGTTTCAGCCGACGCCGCTTCGACATCCTCT
TTCGCCGGCTCGAAGTTCGAACTCGAGGATGATGAGTCGCTCTCGTTGGCCGAGAGGTCCCCCCCCCCGGAGCCCCTGCTCGACCGCGGTAGTGTTCAGC
GGGAGCGCCAACGGCTCGACCACCGGCTCAATTGATGTGAGCCTCTGCTCGACCGCCATCTCGTTCGTCTGCGGGAGCCCCTGCTCGACCGCCATCTCAT
TCGTCTGCGGGAGCCCCTGCTCGACCGCCAGTTGGTCTTCATCCCCGCGTCGCAGCGGGGATTCGTCAGTTAACAGTACTGTGCAAGCCGTGCAGAGAGG
GCCATCGCTCACTCTGTGCACAACGTGCGTCGTGGAAGACCGGTCCACGACGGTGACGTGAGGCCAAGCCTTCTGGGCGACCAGGAGGTGCGTGAACACC
TCGCTCACATCATAATCACTGCGACGCTTGACCGATCGGGCTAGCCAGTCAATATCTGGTTGATAGTGCGTCAACCACGGCATACCCAGGATGCAGGCAA
ACGCGTAATTTATCTCTATGACTGGGAAGTCGTCGTTGCTTCGGAAACCGCCGAACGTGAACAGAAGTGTAATCTCGCGCCGCGCGACGCGGCGTGATTT
TTGATCGGCCAGCTTGACAGCGACCTCCCCTCTACCTTTGCGGACAGTGATGTCCGACGGGAGTACCAACAAGCACGACGCGCGGAAGAAGTTGTTGGTC
GCTCCTGAATCAAGGAGCGCTCTCTGTGGTCGCCGGGCACCGGCGACATGAAGACTGACAATGACAAATCTTGAATCGCTCGGCGTGGTGGTGGCATGAA
AGTGTGCATGCAGCACAGGAGGGCTAGGAGTTTGGGTTGCCACCGGGGGGCGGACCTCCATTCCAGCCAGTAGGGCGCCCCGCACCTACTGACCCTGACC
GTTTTTTGGCTGGTCAGAACCCATGGGCTCGGCATCGACATGCGCAAGCACTGGAGCTGGCGTGCGGCACTCTGCCGCGCGATGACCGACCTTCCGGCAG
CGGAGGCAGGTGAGAGAACGACTGCTCCGAGCATCGCTCCGACGCGCTACATGACGCTGGCGATTGCTCGTCGCATCGATAGCGTCGATGTCCATGGTCT
CAGGCGCAGAATCCCGAGCTGAAGCAGGTAGCGCGTGAGCGAATGACGCCGCAACCACGTAGTCATCGCGTAGGGCGAGGGCGAATGTCTCTTCGAGCGT
AGATGGGTCCGATCTTGTAAGGCAGTAGCGCGTCATGCCTTCGCGCATATCGAACACGAACACATGAGCCTGAGAGGCCATATCGATCGGCTTAGACACG
ATGCACGACGCGAGGTGTCGTGTCTTCTGGACGTAGTTGCGCATAGTCATCGTGCCTTGCCGAAGGGCGAAGAAGTCTGCACGAATTCGGGATTCATCTT
GCGGCGGCTCGAACGCGAGCCGAAGGTCACTCTGGAGGGTATCCAGCGTGGGGAAGACGTTGGGATCGACAACCAACTTGCCGAGAGCCCATTCCTTGGC
TTTCCCAGACAGCCGCGAAAGGAGGAAATGGACCTTCGCGGAAGGCGCCTCGATCAACCTCGAGGCGATGGCGATCACTCGAAACCAGCGATTCAGCGGA
AGTTGATCTTCTCCGGCACCGGAGTAGGTGGACGTATCTAGCTTCACGACGTCATTCGTGGAGATACGCAAGGGAGTTGACACTCGCCGATTCGCATCGG
CGAGCTCGCGCTCCATGAATTCTTGTGCCGCGAGGCGGTGGAGAGCTTCCCACTCGATCCGAGTGAGATGGAGGAAAGCGGCGTGGTCGCGGTCTTGGCT
CATGTCGAACTTGGTCGTTGGAAGGACTACGAAGTGCTACCAGGTGTAACGGGCAAGGTATTTACTCCGTTACTTGCTTACAC