Description :
From Genome Similarity Track
Location :
contig_59:126318- 129832
Transcript NameFunction/comments
g10593.t1hypothetical protein

Sequence
3514 bases(100 bases per row)
CGCCGTCGGACTTGTCGCGGCCTACCTGCAAGTGTACTGCTGGTCCCTCACGGCGTCGCGCCAGTCCAAGCGCATCCGCAGCCTCTACGTCAACGCGATC
ATCACCAAGGAGATCGGTTGGTTCGACGTGAACGACCCGATGCAGTTGTCTTCGCGTGTGACCGAAGCCACGATCACCATCCAGGACGGCATCGGGTCCA
AGATGAGCGACATGCTGCACTTCTCATCGACTGTGGTGGCGGGCATCGTCATCGGCCTAGTGAAAGGCTGGGAGCTCACTCTCATTCTGCTGGCTGTGAT
CCCGTTCGTCGCCGTCAGTGGCATGGTGGCGAAGAAAGTCATTGTCGCCGCTACTCACAGCGGCATGCAGTCATACGCGCAGGCAGGTGCCGTGGCGCAA
GAGTCGCTCAGCAACATCCGCACGGTGCACATGTTCAACTCTGTGGGGTACTTCGTTGAAAAGTACAGCCGTGCGCTCGAGGGCGCCACGCGCGCTGGGA
TCAAGAAGTCTTTTGCTGTTGGCTGGGGCAGCGGACTCATGTACATGATGATTTTCCTGATGTACGCGCTGGGATTCTTTATCGGAGCTGTGTTTGTCGC
TCGCGACAACTTGGACGGTAACTCGTGCACAGGATCAAGTTGCTACGACGGTGGCCGTGTCTTGACAGTATTCTTCGCAGTCTTGCAAGGTGCGATGGCA
CTGGGCCAGGCAGGACCCAATCTCCAAGCTGTTTTCTCCGCATGCGCTGCTGCCTTCGATGTGTTTGAGTTGATCAAGCGTCCGTCACTGATCGACCCCA
CCAACGACACACAAGGCAAGACACTCAACACGGTCTCTGGAAGCATCGACATTGACAACGTGCGGTTCGCCTACCCGTCTCGTCCCGAGGTGGAGGTGTG
TCGCGGGTACTCACTCCAGATTAAGGCTGGCGAGACGGTGGCGCTAGTTGGTCCGAGTGGCAGCGGCAAGAGTACGGTGATCTCGTTGCTGGAGCGCTTC
TACGACCCGCTCGGGGGCTCCGTGAAGATCGACGGCGAGGACGTCCGCACACTGAACGTGAAGTGGCTGCGCCAGCAGATCGGTTTGGTGGGCCAGGAGC
CGGTGTTGTTTGCGACGTCAATCATGGAGAACATTCGCCACGGCCGGCCGGGAGCGTCGGATGGTGAGGTCGTGGAGGCCGCCAAGATGGCGAACGCCTT
CAACTTTATCATGGAGTTCCCCGAGGGGTTTGCGACCGAGGTGGGCGAGCGCGGCGCACAGTTGTCGGGAGGTCAAAAGCAGCGTATTGCCATCGCGCGA
GCCATCATCAAGAACCCGCCGATTCTGCTGCTGGACGAGGCGACGAGTGCGCTGGACACGGAGAGCGAGCGCATCGTCCAGACGTCGCTGGATCGGTTGG
TGGCACGGTCGAATCGCACGACGATCATTGTGGCCCACCGGTTGTCGACTATCCGAGACGCAGACCGCATCGCCGTGCACAGTGGCGGTCAGATCGTGGA
GCTTGGCTCTCACGACGAGCTCGTGCGTATTCCCGACGGTCACTACCGGCTTCTTCTTCAAGCTCAATCGCAGCCATCTGCTGAGGAAAAGGCTATAGGA
GCCGACAAATCGATGATGGTAGACGTACCGACCGAGATCGATCGGAAAAGCTCACAACCGGTGCAGTCTGCCAGAGCGTCTAGCAAGTCCAGTGGACCGG
CAATGGGAGCCGACACCTCAAGTGAAATCAACGACAGTGAATCCGGTTCCACCGAGAACACCTCGAAAGTCTCCACGTCGCGCATCTGGAAAATGGGTCT
ACCTGAGTGGAAGTTCATGGCGTTGGGTGGAGTATCCTCCGTGTTTAAAGGCGCCGTCTACCCGCTGGCTGGCATGTTCATCGCCAAGATCATTCACTTA
TACTTCGAGCTCCAGAAGACGAAACACGAGTTGCTCCACGACATGCGCTACTACTCTCTGGCGCTGGGTTGTCTGGCCATCGTCTGTGGCGCGTCTTTCA
CGCTGACGGAATATTGGTTCGGTATAGCTTCGAGTCGGTTGGTCACTCGGGTCCGTCTTGCGACGTACAGCGCTATGCTGCGTCAAGAGGCGGGGTGGTT
CGACCACAAGGAGAACTCGTCGGGCTCCCTTGTGTCGCGTCTAGCTACCGATTCCGCTATCCTGCAGTCGATGACGTCCGATTTTCTCAACCGCAGTTTG
ATGACTGGCACGACGTTTATCATCATCTTCGCCATCTCGTTCTACTACAGTTGGGAGATGACTCTCATCATGATCGTGACGACCCCATTTCTGGTGGGGG
TGAACTTTGTGCGCTTGCAGCAAATGTCTGGCCAGATGAACGCGAAGAAGAACAACCACGCTGACGCCGCCGCGGGGTCTCTTTTGTCGGAAGCCATCGA
CTCCATTCGCACGGTGGCGTCATTTGGAATGGAGAAGTCTCTCACTCAGCAATACGCGGCGTTCTTGGACATCTCGAATGATCAAGACAAGAAGCTGAGC
GTGTCAGGAGGGGTTTCTTTCGGGCTATCGCAATGTATGATGTTCTGGGTCCTGGCCTTTGTTTTCCACATCGGCGGGATCTTGGTCTCGCACGGCACGA
TTAGCTTCGAGGATCTCTTCGTCGTCCTCATGGTCTTCATGATGGGCTCTTTCAGTGTCAGCATGGCCTCACAGGGATCCGTTGACGGCGACAAGGCGAA
ACGAGCTGCCGCCGACGTCTTCAAGATCATCGACCGCGTGCCGGAGATTGACGCCACGTCCACAGCAGGCATCGTGCTACCCAGTATCCAGGGCGACATC
GACTTCAAGCAACTCACGTTCGCGTATCCGTCGCGGCCGGACGCCGTCATCTACCAGGGCTACGACCTGTCCGTTGGCCGCGGTCAGACTGTGGCGCTGG
TGGGCGCGAGCGGCAGCGGCAAGAGCACAGCCATCGCGCTGCTGGAGCGGTTCTACGATCCGTCGTCGGGCCTGGTGACGCTGGACGGCCACGACGTGCG
CAGTCTCAGTCTGCCGTGGCTGCGCGACCGCATCTCGCTGGTGAGTCAGGAGCCGGTGCTCTTCTCGGGGACGATCGCCGAGAACATCGCTCTGGGCAAA
CCCGGCGCGAGTCGAGCGGAGGTGGAGGCGGCGGCCAAAAGCGCGAACGCCTTCGACTTCATCTCGAACTTCCCGCGGGGCTTCGACACGGAGGTGGGCG
ACCGCGGCGCGCAGGTGTCGGGCGGCCAGAAGCAGCGCATCGCCATTGCGCGCGCTATCCTGCGTGACCCGGACGTGCTGCTGCTGGACGAGGCGACGAG
TGCGCTGGACAACGAGAGCGAGCACATTGTGCAGGCCTCGCTGGACGCACTCATGACGCAGAAGCGGCGCACGACGATCGTGGTGGCGCACCGCTTGTCC
ACGATTCGGAAGGCGGATGCGATCGCTGTGACGCGAGAGGGAGCCATCGTGGAGCTGGGCAGCCACGAGGAGCTCATGCGGTTGCCGGGTGGGGTCTACC
GCGGGATGGTGGAG