Description :
From Genome Similarity Track
Location :
contig_120:1263- 4315
Transcript NameFunction/comments
g13924.t1hypothetical protein

Sequence
3052 bases(100 bases per row)
TCCAGTCGCCACGTGTCAGAGTACACAGTGCAGCTCCTATGCGCTATGGGATGTGAGCCCCAAGTGTTTCCGTCGGAAGCAGACCTCCGAGCATGGGCAC
CCGAGGACGCCGCTACGGCGCTCCGAAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTCAGCCGTCCACCGAACGTCCACCA
CGCGTCGGATCCAATCGACCCGTCCATGATTCTGTTACCATTGGCCCCTGGGAGACGCCCCAGAGAGTCGACCGAGGCCGGAATATTTTCGGCCAAAGGT
GCGACCTCGACGTACTTCCAAGACTCCCACATGGTAACGCCTAGGTCGATCAGTCGTACGGAACGACTGGCGAGAGAGGCCGAGGGATACCGAAGCGCTC
CAACTGCTGGACAAAGCGCAAGTCGGACGCCTAGCTGACGTTACGACCCCCGCGATGACTCATTTGACGAAGATTCGTTCGACGTCGGAGACACCGGGGG
TGACCTGACGGGAGAATGGGCGCGCCAAATTCGTGAATTGAGCGCTGTGGAGAATGACAGTGCGACACCGAGGCTAGAGATCGCGACGCATCTCCCACTC
GGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCAAGAAGTCCATGCAGTGGCTCCGAGCTTTCATATACGAGATGAAAGGGACGCACACGCCGC
CCAACGAATGGTGCATAGCGTTTGAATTGAGCCTCCAACATGGTGCTCTGCACTGGTACCGACAGCTGCCCCGCAAAACGAGGCGCACGTGGAAATTGTT
GAGCGATGCGTTCATCAAGTACTACTGTTCACGGTTCAACCAGTCTGCGAAGGTTCGGTACTATTCGGCCAAGCGAGAGCAGAAGGAGCACGTCTGCGAC
TACCTCAACCGACTCAACGGCTATGCTCGCAACGCCGGAGTGCAGTTTGAGCATGGCGGTCGTGATGCAAAAGACCATGTCGAGCACTTCTTGGATTCAT
GCGAAGACCGAGGTCTGGAAGAGCGTCTGTGCCATGTCCGAGTCAAGAACATCCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGGGAGCG
AAAATCGGGACGCGAGTCCTCGGTCCGCTGTCCTCGAGGACAAGAAGTGGTACGCCGACGCTCCAAGGATTCACGGGACGGCTATCGCCGCGACAGGCGT
CACCGAGAGGACGACCGCCGTCGGGAAGACCTTTTCCGAGACGAGAGCCGTCGGGATGACCAGCAGTACCGACCGAGGGTCACTCTCACTGAAGCACTGA
CCGACATGTGACTGCGCTGAATGTGGGACGCCCAGCGGACTCGCGAGGAGGATACCCAGAAGTATACAACGGTGGATATGATGACGCCGAGGAGTACGGA
CCGGAATCTCACTCTGGCGATAACGACCGATATTCCGAAGGGTACTCGGACGACGGATATGCGTCGACCGAGGATCAAGGCCACGTGGCCGCTGCAAACG
CCACTGAACGTCGTAATGCGGCTGAGGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAGGTAACGGTCAATGCCCGTATGACCGAGACGACCG
GCGCCTCAACTCAACCGGACGCGATGGTCGATGCCAATATGGTCCATGCGCCGCCTGTGGAGGACTCACCCATTCACCTGACTACTTCTTTGAGCGATGC
AAGATGTGCAAGCAAGTTCACGATGTCGGAAAGTATGAAGCCTTCCAAGAACTCACGAATCTCTTCCGAGCTAAGTTCGAGAAGAAGGACCTCTCGCCGG
AATTGCAGGAACTCGTCTATGGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACGGTTAGCCAAACCTGC
GCTGGACGCGTACTATCTGTTCGCATTCGCAGGTGTGTGCAAACGGCCTAATGACGTGAATATGGAATATGTGAAAATGGTGGAAAATGTAAAGGAGAGA
GGCGTAAGCCTCGGTGAGAGTGAAGTGAATTGGAGACGTACGGACGGAGACGAAGTGGAGTTAACCGAAGCTTCGATCATCAGCATGGCCAAAATCGACC
ATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAGCGGTACGACAAGAGGAAGCGATTGCGTGT
CTTTATCAAGGGGCTGTGAACGACTCGCGAACCAGGATTCTGCTGGACACGGGAGCGAATGTCAGCGTAATTTCCGCGTCATATGTGAAGCGGTTACGCC
TGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCAAGGAATTAACCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGG
CTGGGAACGCGTGTACGAATTTGAAGTATGGATTATGGATCACAGTGCAGGAGTAGATGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGG
TTGGATCTGTTCCACGGCACTGCGAGACTACCGGACGAGGTAATGGTGCCCTTGGTGAAGTCGCAGAACCCGGCAGAGGCCGAGCCGTACAGCATGCAAG
TGACTGGACGCCCGACCGAAGACTTGTCGGTCCCTGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACCCATGAAGTGTG
GGCCCGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGGGGGCAGCCGACGATGGTGCGACTAACAAACGTGTCACCGAGGATTGCTCAT
TGCGCGAGACACGAGTCGGTATTGTTGTGGGTGAAAGGGGGTGACCTGCCGCAAGGAGATGGATACACTCGTTTGAACTCCGCCAAGTATGAGGAGTGGC
AAGTCCTGGCGTACGCAGAGTGTCGAGACGAGACTCTGTTCGCGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGACCAACCACCTGCAGTAGAGCG
ACGAGACTACCTGACACCTCGCGGCATCCTGCTTCGACCATCGGACGACTTG