Description :
From Genome Similarity Track
Location :
Scaffold_174:1263- 2786
Sequence
1523 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTCCTTCTATTCCCAC
AGCGACGACCCTCCGCTGCGTCGGAGGCAACGACGAAGGGAGAGGGTCAGCGGCGCTCCTTCCAAGCGTCATGACCCCTACGCATCGTCGTTGTGCTTTC
CCATACTCGCTTGTCCAAGCTTGATGGGTGTGGAAAAGTTGCCTTGGGTATCGATATCATTTTGGTCGGACGCGCACTGCTCCCTTCGTCCCGAGAGGCT
ACCACGTCATAGAACTACGGTAGAGATCGATCGTACAGCACTTGAATCCTTCGCCATCGTACATGTCATCCGAATTGTGTCTATCAACGTACTAGTACCT
GCGTTGGCACACTCTTCAACGGTTCCCTCCTCGCGCCTTCGAGATGCTCGAGTGTCCGAGTGCATACAACGCTACTGATTCCTTTCACACGTGGTTGTGC
TGTGACGAGTTGAAGTACCCATGGAAGAAGATGCTCGATCAGCATACCCACAACGTCCATTGAGGATACAGTCGCATCAATCGGTTGAAAAGTGGCTTTA
GCTATGTGTAGATCATCCTTCTTTTGCCTCGTCGCACTTCAAATTCCAGGTTTCTACTCGTTTTCGATAATATACAGTGTATACCGCGCATATACAGTGC
AACGTTGGCAGCCCTCGATGTTGCACCTTCTTGACTCGTCCTAGTGCACCCGACCGGTAGGCGACAAATAAGACACAATAAGATTAGAGAATGGGATAGT
AGCCTTGTCGCCGTACCGGTATGCGATCGTCTCGAACCGGCAGCAGCTGCAGACAATGGCTTCGCAATTTGCGGAATCATTATGGAATGTGGCAGCGAAA
AAAAGTCGGATCGCGAATCGAGA