Description :
From Genome Similarity Track
Location :
Scaffold_874:12629- 14293
Transcript NameFunction/comments
Phypl_g11396hypothetical protein

Sequence
1664 bases(100 bases per row)
CCAttcctgctggtgctgtacCACCATGATACCGCTTCCGCCTACCGTAGGTTCAAACTTTATTCTATCATATTTTTGTCATATTATGGGTTATGGTAGG
GTAACTGCCAACCACCCGTGAAGGACCGGTTTGGCTCACCAAGGCCACTGCCGCTTGATCTTCAGTCTTCTCCGCCCCGAGGACTCTCATTTCATAACTA
GTTTCCCAAGCAAGTGTAGTCCCCTCTTTGCTGACCTATGTATCctcatcaccaccaccatgaAGTTTTCCAACAAGGATCTGTGCTGTCTGCTCTTTAA
TGAGCTCTCTCCTGGCAAGTGGAAGTGCAACTCGTGCAAGAAGGTCCACAAAGAAGGCTGTGGCTATATGAACCAGATGCATTATCTCCTGAAGAAGCAC
CCCGACTACCTGCAGATGGCGGAGGCCTTGTTCCGCAAAGGAAACCGTCTCgggctgtcgctgcccgaCTACCTGCAGATGGCGGAGGCCTTGTTCCGCA
AAGGAAACCGTCTCgggctgtcgctgcccgaCTACCTGCAGATGGCGGAGGCCTTGTTCCGCAAAGGAAACCGTCTCgggctgtcgctgcccgaCTACCT
GCAGATGGCGGAGGCCTTGTTCCGCAAAGGAAACCGTCTCgggctgtcgctgcccgaCTACCTGCAGATGGCGGAGGCCTTGTTCCGCAAAGGAAACCGT
CTCgggctgtcgctgcccgaCCAGTGGACAAGCGAAGTGTTTCGCTGGATCAAGTGGTGCGTCGTGGAACGGATCCCTGTGAGTTTTTCTGCGAGCGCCC
CCTCGTTGGTAAAAACGCTGCAGCTACGCTGATGAAGTACATCAACCTACTCTACGGGTACGTTCGTGACGTCATCGCTGTCAAGCTTCCTGATCGGTTT
GGAATCATCCTTGACGGATGATCTAGTTGTGGGCGTCACTTCGTGGCGATTATGGCCGTACCAGCACCGTCAATGATGGCCAACGCAATCCCAGCTACCA
CGTGAGTATCCAGTGCATTTCGGATCGCTTCGTACTGCTAGCATTTTGCCCGCTTGCCGACGAAGAAAGTCTGGGAGCGCAGCGTTTGTATGACTTGATC
GCCGACACCTTAGCGACCTTCGATAAGCCATGGAGCTGTGCTTTTCATGACTGGAGATAATCGCTGAGTCAATCAATTATGTGGTCAAAAGTGGGTGCAC
TGTCTTTCACTGGCTGCGCTAGCCACCGGTTCCGCTTGGCAGTCAACGACTTTCTGTCCGATGAAGAAGTCTTATTGGCTAAATTCCACGCCTTGATGAA
GCATCTCAGTACTATCTTGTACCGTGCCGCACTACACAAGGTGACACCGCTGGCACCGGTCATGCGGAACGCTGCGCGTTGGTCGAGCAATTCTGCTATG
CTAGAGCGCTATATCAAGCCACATGCAGTACTACTCACCCTGGACCGCGCAACTGTGACCAATCATGGCATGGCGACCGTTTTGAATGGCGGAAGCGGAG
GCATCCCACGCccacgacctgctggaaAGGCCGGAGGAGCTGAATGAGGTTACCAAGGCATTGCAAGACTCGACGCTGAGGTTGGTCGGTGCTCGTCGTG
CATTCGACCTCGCCGCAAACAAGTACGCTCGGATGAAAGCGCGACTAGCAAGTCATGCACCCGT