Description :
From Genome Similarity Track
Location :
Scaffold_15:126280- 129747
Transcript NameFunction/comments
Phymu_g1091hypothetical protein

Sequence
3467 bases(100 bases per row)
GTAGCGGCCAAATGCTCGAGTTTCCTCTGCATGATGGCTTCTTCCCGCAGATTGCACTGTCGCGAGAGGAGGTCAAGTACTACAAGCGACTGGGCAAGGA
GCGAGTGACCCAGCTAATCCGCATCATTGAGGACGCCGACTGCGCCTACAAATGGACCAGCGCAGACGCCACGCACCGCAGCCACCGCTCGCGGCTCCCT
GGGCGCGCACGCCTCGGTCTGGAGGCCAAGGATGAGCCGGTCGTGACGTGCCAGCGTGCGAATTTCCTGGACTTCCAGCCTGCCAATAAATCCACACACG
CGTCCACCTTACTCAAAGCCAGTGTCCAGCTAACGGACACGAAGGTGGACGAGGTCTTGCGAGCTGTGGCGAAGGTCAAGACGAAAGATTTCAGAAAAGC
CATGCGGTACATGCACggcgacgccttcgtggaTGGGAGGACGCTGTTTACCTTCCCGCAACATTCTTCTCGATCCGGCAGTGATGCCACAGATAGAACC
CCGTCGAGAGCTTCGTACTCGTATCGGGCCATAAAGTGGCACGCTTTCAAGACCCAGCGTCCAAGACACGGAGAAGACCAGAAGATTTTGGATTTCTGCT
TTTTAGAATacgccggcaagaagaaacccCACCCCGGATCTAATGTGGTAGGGTTCTGTGTCCAGGAATCTATTtctcgagatcgagaagtGCCCACTTT
GGAGAATTTCGGGATCGCGAGAGGATATTTGTCTCGAATGGGCATTATTGTGTCCAAAACGCACCAGCCCAACACGTTCAAAGTGACTTCTATTTGCCAG
ATCGATGGAGACCTCAACCCGATTGTACGAGGGGTTCTGGAGGAATTAATGAAGAAAACAGTGTGCGCAGTGGCTAAAATCCCCGGACTTTTAGCTCGCC
AGCGAGTGAGCAGCTTGAGAttcgtggagcagtggcAATGGGTGCCCAATTCGGACCGTAAAGCTTGTGCAGTTTGCTTGCGGGGGTTTTACTTCCGACG
CAAACACCATTGTCGAACATGTGGAGAAGTGGTTTGTTCGTCCTGTGCGTTGCTGAGAGAATTGGAAGAGCCGATTTTTGACATCACCCATTTACGTGTC
TGCTCTGCCTGTATGACCAGTGCTGGtgcacgacagcagcagttctcgGCCGTAAGTGCAACTGGAACTGGGGATGAACCTGCTTCATCTACATCCAACG
ATACGGAGTCGTACATCCGCGGACTACGCAGTCCACAACACAATTCTTACGAGGATATGATCTTCCAGATGCGCGAATCTCGCGATCGCGATCGCCGACA
GAGTGACCTGGCaatggaagtgctggaagcaTCGGACACCGAACTGAAGCCTGCAAACCCCGCACGTAAAATTGACGTCAGTCCACAACTGCGGCCTCAG
GACAAAATGCAGGCACTCACGGACGTGGTGACTCATATTCGAGAGGTTCGGGACACTATTAACCTTACGATGTCCGAGGCAGCGTACGGAGAACGGCAGC
ATGAGGACAGCGATGAAACTGAAGAATTCAATGATATGTACAGTGAGATCACGAGCATCcgtgaggcgctggagagctcCGTCTCAAACTTTGATGCTGC
ATTGGCGAATGCTACGAATGCTGCCCCTGCAATGTATTACTCTGGCCCAAGTGACCGCAGTCAGGACTCTTTACGAGACGGCAGTGAACGAGACGGCGAG
ATGACGCCTGATCAATTCAATTCGGTTGCTCGCATCAccttcgcagcagctcgagccaCGAGTCAGGCCGGTCAAGCGTTCTTATCTGTTGGAGATCGCC
AGCAGGAACTAAATGACGCTCGAGAcaaccaagaagatcacgatGATGACGCCGTATCAGCTAGCTCAGCATCGGTGGCCAGCTATCCGACAGTGTACGA
CAGCGATGATAGCTCGACTCAAAGTCCCGACCCATATTCCGCTTCTAACTACGAGAAAATCATGGCAACGTACCAACCCGAACACGATGGTTCGGAacac
gaagatgaagatgacaGACGCTCCTCACATAAATTCGCGAACTCTGTACGCCGCGCGAGTGAAATtcacgagctggagaagaagatccgtGACCTGCAGC
GTAGCCTGGAAGACGCGCAGCGAAAGCTTTCAGTTatcgacagcgacgagcCCGAGCCTGAAGCCAGATCACGTCAACAACTAGATGCTGTGCGTGATCG
TTCCGCGCAAGTGGAGATCGAGAGCGTCTTTGAGATCTTTGGTGAGCGTGGTGAAGAAAAGAACCCAGTCCTTGGGGATGCAGCCTCATCCGTCTCGTCC
GGTCCCAGGGCAATGTCGTTGCCTTCTGAAGCAATGGGATCAAGAGGCTCAACGACGCAAGATCTGGTGTCGGAGCTTCGTGGGGTCATGGCTTCCAGTG
AAAATCCTGTCCGCGTTAGTGGTGGTTCACGGAAGTCCATGTCCAGGTCGTCAACGCCTCCACCTCACCCCTCCGTGCCAAAGACTCCAATTagtcctcc
tcctccaccactcCCGGCATCCCCGGTATTTACTAAGAGTGTGTCTCCGGACTTGAAAATTCGCCACTCGCTGCCAATTAAACCGAAAGCCAGCTCGAAC
GGTGGCCTAAACGACAGCCACGGAAGCAACAAGAAAAACCAAGCGAATAGACACAACCGGCCTTCCGCAGCACCCACTGAGGGATCCTATTTGCAGGCGT
TAGGTACTACCGGGGGAACTCGGTATGGCGGCGACGATGACtacgcttcttcttctgatgAGGAAAGTTACGACGACTCGTCCGATGATTTGTCGCTGCT
AAGTAGTGAAGAATTCCACGAGCCCCAGTTCAAGAAGTATCAAGGACCTGACGCATTTTTcgtggaagaagatcttggtgctctgctgaagaagaggaaa
gcAGCGGAAACTGGGGCGTCGCCGCCTGTTAACCCCGCGGATTCCCCATCCTCTCCATTGCCTTCTGCGCCTGCGGTTAGCAGGGACGAACGTGATGAAC
TTCGAGAGTTAATGGCGGGACTCGTCCGTCCTCGAAGTTCATCACTTCCGTTTCAATCAAGCCAAATGGGAGGCGCGTCATCCGGTGAGCCGCTTCACCC
CTGCGAGAAACCATCCTGGAGCGACGACGCTCCTGACCGCGTCCCGACAGCTCACCAGGTGGATGAAGCTGTACGCGAGATCCGCGCTTGCCTGGCAAGC
TGCCGATGTGAGTGTCCATCTGACACCGAGCGAGCACGAAAACTTACTTCCATCTTCAAGGTGCTACGGTCTCTTCACCGCGAGGGCGTGCGCTCGAAGT
TCCGTACtctgcagcacgacgacaTTCGCTACTCGAAGATGCTCAAGGCGACACCCAGCATTatcaagctgctcaagctcgcTGGATACGTTTCTCTGCA
GCAAAAGCTCACCATGCGGCGCGTGGATCAGGATTACCTCGCTCTGTTCCTGCGGGAATTAGAGCTG