Description :
From Genome Similarity Track
Location :
Scaffold_55:126271- 128211
Sequence
1940 bases(100 bases per row)
GCGTAGACGGGAATGGCATGTCGTCTCACATTTCACATACATTTTCAGCTTTTTGACTATTCACTCTGCTTTTGAAATGAAGAGAAAGGGCTTTTGATTA
TAATGAAACGAATAAAACGATACGTAACTGTATTGACTGATATTGTCGCAGTCATGTATGATTTGGGAAGCGACAACCGCATAATTTTCTTTTTGCTCTA
ATTACGATTAGTTATGGAAGCCGCTATTGAGCCTTCAGTTTTCGCTAATGAGCCTTCACCCCATACATTCCAAGTAATTGGATATAAAAACCCTTATAGA
TTGTCAAGTTGTTTTGTTGTACTTCTATGCTTCCAATTTTTTAAATATTCACAGTCGATCGCTACAACACATTATCAGCGGGACAAGAAGCAGCAGAATA
CGTTTAAACCAGCGACACAGCGCAAAACAGTACGAATAGACGAAGCGGGTTTTGCTGCGTGGTGCTTTATCGTGATCGTTCTCAAAAGCGCGGAATGAAG
TGATGGTCGAGTGTAGGTTTCGCGCTTTTTGTTTTAATTGATAAGACTGCTAAGATTCTACAATTCCTTCACTTCTTCTCCCACGCTTCAGGTGATGCCG
TCGCTCGTACCATCATCGCTCTTGCTTCTGATACTACCTGAACTCTAGCTACACAATGCTGTCGCTTAAATCTATCCCGTTGAGATTAGATACTGGGTAC
TTCCGTTCAAAAGCGCTGAGAAGCCGTTCGCCACCGACCAGACCCCATCCTCGCACGCATGGGGAACTCTAACGGCGTATTCTGCGTGACTTGCAGGATC
AGAAACTTTTTTGGATCCACATGTATCGTTGGTTGGTGTGGTCGTTAGCTGGCTTCATCGTGTTTTTCATTGCTCTTACGGACGTGGCCGGTGGCAGTCG
GCTAAGTATATTTGAGTAGGACGTCGAGTGGGAGTGGATGCATCATATAAAAAAATTCAATATGCTAGTTAGAGAAAGAAAGAGTGTAAGCTAGGCTAAA
TCGCGGACGAATACACCTGTCATGGTCACGGAATACGCAGGTAGCCCCCCTCCCCAACAAGAGGCCACGGAGCGCAATACAGCGAAACGACGACGCAGAC
CGAAGAGCAGAGATGACGCAAAAAAGGAAATGGCGATGACGAAAAGCATGAATCCAGCGCGCGTAGCTGAAGAAAATAGAAAATAGGAAGTAGTGAAGGT
AACTGGGAGTAGCCCGAAATGGTAGGTCATAAAATCTAAAAATAAAGCTTCCCCACAACCACGGAAGTATTCGGTAGGAAGAGACACGTAGGGAGGAATA
AGCGAACCAGAAGAGACCAAGCAATCGTCATCGAACCCAAGCGCGCATTCCAAGCAGATGTGATAAAACTGATGAAGGTATCTCCAGCAATCGATAGTGC
CGCACCGGTCGTAGTAACGGAGGGCTAATGTCGAACGAGTCCGACCAAATCGTCAAAATATGGTACTGGAAAATACACCACACCAGCGCAGTGATGGTCG
GTGGAAAATCCCCCAAGCACCTTGTGAGAACCCAAGTGCACATTTCAGGCAGCAGTCGATTACTTTCAAAATACCTCCACCATTTCGTATTGAAGAACCG
ACTGTGGTGATGGAGCTAATGTCGAGCGGGATTGACCAAATCATCAAAACATAGTATTATGGGAAGATACCCCGATGCAGAGGTGGTCGATCGAAATTAC
CCCATGCAATTTGACCGAACTCAAGTGCGCATTCCATGCCGCCATAGAAACACGGCAGGAAGCACTTTCAGTAATACGTACGGCCGTATCGTCCATATTG
ATGGAGCTAATGTCGAGCGAGGTCGACCAATTCTTACAAAACGTTGTGGTTTGGGAAAATACCCCAGAACAGTCGTCATCGGTAGAAAATCCCTTAAGCA
CCTCGAGAGAAACAAAACGAGCATTCCCGGTAGCAGTATA