Description :
From Genome Similarity Track
Location :
Scaffold_10:126263- 133560
Transcript NameFunction/comments
Phymu_g806hypothetical protein PHYSODRAFT_349212
Phymu_g807hypothetical protein PHYSODRAFT_552366
Phymu_g808hypothetical protein PHYSODRAFT_552363
Phymu_g809conserved hypothetical protein

Sequence
7297 bases(100 bases per row)
ATCTCATGTTTTTAGTCCGATCTTTTTTTTGTATCACAACTTGTGATTCACAAGATGCTGCCAAGGAGCAAAGGCAAGGACGATGGAGCGGCAGGAGCCA
ACTCTGCGGCGACAATCTGTGAGCTATGCGACCTGTACACGCGCAATGACTTGGACGGCAAGTGGACGGAACTCGCGGAAGTCTACGACGTACGATATTC
CTCTCAACACACCACAAGGATCCGAACTTAACTCATTTTTGTGTAGCAACGCCGCAACGTCGACAACTTCCGGGAGATTCTGGATCTGAGCGCCCCCAGT
GCCCGCATGGGTGACCTCAACGGATGGCACTTAGAGCGCATGGCCGTGGGCGAGTTTGAGCCTGGGGCCGGGgccaacgccagcgactTAGCGGTTATTA
AACGCGAGAGTCGTCTGATCAAGCAGACGCTGATGAAGGTGATGGCGAATGGCCGCGATTTCAAGGCCAAGCGAgatgagctggaggaggcgatgGCTAA
GCAGCGAGAGGCGCTGACAGTCGAATTGACTGAAGCCAAGGAGTTTCTGGGCCAGGCACATTTGCTGAACGCTTGTGACTCCGCTGCCATTGAGGTTAGT
GAGCCAGCACCTGTTGAGGAACGCCTGCGGTCTACTGTTAAACACCCGGAGCTGTCTCCAACGGTTGATCTAAGCGAAGCACCATCGATCTAAGTATGAA
GAAGCGTAAGGACATTGGAACAGGGCGGAACTCCAGTGCATTCGTCCGGTGCTTCCCGAAATTGGCCACACTCTATCTGTGACTTGACTAAGGCCACCCC
CTCGCTTGCCCCTCCTGACTTTCTGTACGTGCCCACCTGTCGAACTGCTGCTACATTCTAGTCGACGTGAAGACGCTCCTCGAGGTACTTGACGGCGTCC
TTCGTGATGATCAACAGGTCCTTTTGCAGGATCGAGTAGACGTTAATCTTGTTCTGCGCGATCGTGTCCACGTACGGGATGTTGCGCGTGGCCAGCTGGA
AGCTCGACTCCACTTCCTCGCCGCCCACGAACAACGCGTGATCCCAGCCACGGccgcccagcagcttcttcataTCCTTCGTCTTGGTAACCTGTTCGCA
ACAACAAGAACATCAACATGTCAGCACAGACAGCACAACGACAATGCAAAACTGCAAACAACTACGTACGTCAATGTCCAGCGAGTCCACAACGGCCAGC
TTGCCCTCACGGAGCTTCGTTGACAGCGCCACGCGCAGTCCCATAGCGCGCACCTTCTTGGGCAGGCTGTACGAGAAATCACGCAGCACCGGGCCGTGCA
CGCGGTAACCTCCACGCCACTGCGGCGCGCGGATGTCGCCAACACGGGCGCGTCCAGATCCTTTCTGCTTCCACGGCTTGCGCGTGGATCCGCTGACCTC
AGAGCgcgtcttggtcttgttAGTGCCGGCGCGGCGGCACGCCAGCTGCCAGCgcaccacgcgctgcaggatGTCCACACGGTCTGGAGCGCCGAAGACT
TCTCCGTCCATGGTGACGGAGCCAAGGTCCTGTTCTCCCTCGgcgagcgacagcagctgcagctccaggtcgCCCGACGGCGCCACCTTGACTTGCTGCG
CCGCGGCGATAACGCGGGGCGGGGGcatgtgcttctcctcggccaGGGACAGGTTCGACGGCATCGTGGCCGCCTGCGTACTGGCCGCGCGTGCAAGACT
CGCGCGCGGGGCGGACACACTCAGCGCTGCCACGCCGCGCAGCAGTCGGTTCATTGACACCGTCGCCATGGTCTCCCTTGTAAGATGTCTGTGCGGCTCT
CGATGGATGGCGTTGTGCGGCCAATTGAAACACCCAGGCTGGGTTCCTGGGTTTTATGGGATTTTCGCAATTCAATCTGAAATTATATCATTTTTAGCCA
AACTATTTTAGTAAAACTGAAAATTCACGTTTTCTGAGATTAAAATTTAGAGTTTTCATCTCAAAAAGTGGCAAAAAGTCAGTTGTACCTTGCGGCATCT
TCCCCCTGCATGGCGTCGCAACGCAGAGGCTCCGCCCCGCGCGGAGATGGCAGTTTGGCCGCCATCTGCACGCTCATTGAGCGCAGCAACCTGGACCGCA
AGTCCAAGCTCGACAGCACAGGCCGGATCTGCTACGTGCGTATCATTTGAAGTCTCTTGTCTGCAAATTAAACTAACGCACTGCGTTTCCTCTCCACAGG
AGCTGAAAAATGACCCCTTACTGCTCGACAGCTTCCCAATGGAGCGTCTCATGAAGGCTATGCGTCGTCTGGTGTGCGATTCAGACACATCtacacgtgc
tggagctctcaGGGCTCTTCGCTACgctatcagcagcagcagcagcatcaaacaCCTCGTGGATCTCAATTTACCGGTATTTGTGGTGCGTTCGCTGGAG
CGTGAGCAGAAGCACCTGGCGGAGCGTGTTCAAGCGCTGAAAGTTGTTCGGCGGATCTTGGAGATCGACGCGGCGCAGATGCCCACGGGCCTCGTGTGCT
CGTTGACGGCTATTGCAGGTCACAAGGACGATAACATGCGTCGGGTCtgcttggagacgctgcggGAGCTTGCACTGCTGAATGTGGAAGTTGTAGCAGA
AGCCAATGGCACAAAGATCCTGGTGGATGCCATTCTGGAGCCGTCGTTCCAAGACCTGGCCGATTCGCTGTTGATGACGTTGCTCTTGATTCTCAATGAG
CCGTCGACACGCAAATTTATTGAACCTTTTGTGGATTCTCAGGTTCTTTTGGCGCCATTTACGGATACGGACTTACCTGCGGGCAATGAGAGGAGGCAAC
GGTGGATGGCGAGTCGGAATGCTATTGTGACAATGATGCGGTCGTGGACGGGAATGGTGGTGCTTACGAGCAACCCGCAGGGTCTGCAGTCGCTCATTCA
GTTACTGGTGCGGCCAGTTGGAGAGGATGTTCAGAAAGCGGTGCTGTCAACTATCTGCGAGATTTTTTACAAGAAAACGGGCTTTGACAGATcagctgct
gacgctgcggCGGACACACCTGCTCTCCCTGTTAGCTTGTCCAGTGCAGAGCAATTGCCACTCGCAGTCAACCACAATTTGCTGGACAATTACACAGTGA
TTATCCTGCTCGCTATGATTCATTGCGGTATTCTTGAGGCGCTGGTGACTTTGGGAACGGGACCGTCTCGAGCGTTGGCGGATCCGGCAATCGACCTTCT
AGCGGATATTTTACGTATGGCTTCACGTTTGTTGCCGGACCAGCACTGCGCGTCATTGCTAGCACTCCCCCGGCTAGTGTCATCGACTTCGCTTACTACG
ACAACCACAATGTCCCTTGGCGACCATGCGAAGAGCTTATTGGAGCGTCTGCAACGAGAAAAATCAATTCGAGCTAGCGAAATGCTGGGCGAACTGGCTA
ATGCTGTTGGTGCAAACTCAGGGAGCATTGCCACACGTGGCGTGTCGTTGGTATCGTACGGTGGAAGTGGAGTTAACGGGGTGCAGCTAGCATCGGAGCT
TCTGCGTGACACAAATCGACCGTCAAATCTCCTGGCCCTGCAGCAGATTGCGGGCGTGGTACGTCTTCCGTCTTCTAGTGGCGGCAGTGGCATTGGCACT
GGGGGTGGATCTGCAAATTATGCAGTTGCGGCTCCTTCAACACAGCGTGGCACGAAGAGTGCGACTGCGCAACTGAAGGACAGTTTAACGTCACGAGAGC
TAATGGTTCTCGAGCTGAAGCAATCGCTAGATGCCCAGATGGATGACAGCACGTTTAAGGACATGCTGCACAACCGCTCGCGCGTGCTGACAGACAAAAA
CTACAAAAACTGGAATTGGGATATCATTTCCGAAATGCTGGAGGGTCCATTGACAAACCCGCAGCGATTATCAGAGGCCATGAAAaccaagttcttcaag
cgcCTTTCAGGCTTTTTCCGGTGCGATCAGGGCAACAAGGGCTACTTCTCCAACCTATACTGGATTCCAGATCACGTACCCTACTTGCGTCCAGCCTGCC
AGATGTATACGCTACTGTTGAACCACCCGGAAGGCTTGCTTTTCCTGAAAACCGACCGCCGCGGTCAATTACTGACAGAAATCTCATCTgcattggagct
ggaggcacGGCCTGAGGCTGCTATCGTGGAGTCGCACATTGGAGTCCTTAAGGCGCGCATGTTTTCACCGGATTACGTCTCTAGACGTATGCTGCGCGAG
TACTTCACGCTTTTGGGACTCATGAGCTCGAGCAAGGAGGGTCTCAAGATGATGGAACAGTCAAATCTGTTCCAGCGGCTTTACGTGATGGGGACGACAA
AGGGCCACGATTTTCTGTGCCGCCTTATTCTTGCGAACTTGGACTACTCGGTTGACGGCAGCTcccggaagctgctgcagtcttGGATGATGGAAGGTTC
GAAGGCACTGCGCTTGTATGCGACCTGCTTGCTGCGTGCTTTGCTGCGTTCCGAGGTGGCAGACTTTGATAAGTGGGGTATCGATGCTCTCGTAACGCAG
CTCACacaggaggaagaggttGCTAAGGCAGCACTGAGTGTGCTAGAGGAAGCAGCCGAGACCCCAGCATGTTTGTTGGCAATGATCCTGAAGCGGCCAA
TGAAGTTGATCCAGCTGAAGGACAAGCGTGCTGAGTCCTTACTTCTCAGATCCCTTTCGCTAGCCGAAGGGCTGAACTTCCTGCGTGACACTGGTGACTG
GATCCCTCGTACACTTGCCGCCTGGCGTCGTGAAAAACACATTTCTTATGTTCACGCCGTGGAGCACGCGCTTTTCCGTGGCTTGCAccgcgatgctgct
gggcgtgaACGTGGATCGAGCAACAGTGCAACCAGCACAAGACAGACGTGCTCCCCTACTCCCATCCCAGTTAATGTGCCTATGAAGCGAGGTGGTGGGG
TCGGACTCAAACCTCCAAGTGGTGGAAGCAGTCAGCGTTCGTTGTGGGGGCTAGATTGGCTGTACCGTATGCCGTGGAACATGGAGGTGAAGATCGTAGG
TCCTCCTGGAAGTGGCCCTCCTTCGAATCTCATCTTGGAAACGTACATTGACGGCGCAATGCGGGACGAGGATGAAACTACTGGAatcgacgacgagctt
cgCATGAACTCGATTCGCGTAAAGGGAATCGTTGTGGATGCTCGCAATATGCCTCAACCTGTGGTCGTGAACTCACAACAGACACTACAGGCTTGTCTTT
TCCTAGGCACGCAACCTGTGGACCGGCGCGGATTTACAAAACCTCCACCTCAAAGCAACGGAGGCTTCGTGTCTACAAGTGGATCTGCTAGCAGTAGCGG
CAGTGCGCTTTCAAGTGATACACAACAGAAGATGCTACGAGCTCGATCAGCGTCCAATTCAGCTGGTGGGAGCATGGACCGTAGCTCAGAGACAATgatg
tcttcgtcgttgGACTTTGCTGATACTGGATCGTCTTCGGTTGACGCGGTGAAGGAAGAAAACAAGGACTGGAGTTCATGCCAGCCAGAACAGCGATCCT
CGCAGTATCTAACAGCACCGGAATGTTCGTTGTGTGCCCCTGGCGAGCGTGCGGTCTGGAATTTCCGTGTGGAAATGGACTCGGCAGCTGGCACCAACAC
TTCAAACGGGAGCGTCAAGCGTCTCCTGCTTAAGTCTGTCGAGTTTACACTACAATTGCTTCCccttcgtccacgtactGTGCCGCTACCTGTGCATTTG
TATGGTGAACTGGCAAAGACTAGTGCTGGCTGTCAGATCCTTCATTCTTCTGGGCATTTGCCGGAATTCCTGGCCTGCCTTCGTGATGCCGCAAGCGTGC
CACTTGAAAAACGTGCGGCATTGTGGGCACTTGGTCACGTGTCCGCCACGCCACGCGGTTACGATCTGTTGAATCACTACGCTCAAGACTTTGTGGACAT
GATCGTGAAGCTGGCCACGGATTCCCCGCTCGTTTCCATCCGCGGAACCTGCTTCTTTGTGTTGGGCTTGCTTgcgcgatctcctgctgGCCGACGACAC
CTGGCACGGCTTGGCTGGGACGCCCCGCGTGACGCGTCTCGTACTTCCATTGCCGTCCCGCAGAActgcacgtcgctcttcatgtGGCCGCCGTCTGGAT
CCTCAACTCCCTGTCCATTAACGCAGACACCAGGCGCTTCACCCTTGCAGCGCCTACTAATCCGTAGGCGTGACAAGATGCCCAACGAGTGGCGCGAAGT
CTTACGCTATGTGGCAGACCTGAGCAACCACATCACCCAGAAGGAGGCCCATGCTTCGCTCAACAAGCTGCGCTCATCAAAgccggagctgttcgaggag
CCGGTGCTGCTGATGTATGTGCACGCGTTACTGGAGAAGTACAGCTACCGCTTGGCGCTACGCCAATTTGTTCTGAACGCGTTCGACCGCGCCACGTTGA
CggacgaagtgctggacacgctgcggattgaggacgaagaggaacaGGGAAGCCAAACACGCCAACGCGCGCCCACTGGACGAGagctgcggcggcgtcg
cTCATCTCCCTCGATCCCGTCATTTACGACCTCAGTCCAGTCGCTGAATTCCGCCATGCAGGCCACGTCCGGTGTCTCCCGCATGTCCTCCATGCAGAAC
GTACTGAGCTCTGGCGGCAATATGGGTGACCACCGCCCCACTATGAGGCTGAACGCGCACAACGACCCCATCGACCGCACTGTGTTGCTCAAGCGCAACC
GCAAGCGCTCTGCTTTCTCCGAGAAGACCATCGTGGTCGGTGCACCTGAAGCTGTTGTGTAGGCAAGATAGACGAGGTCGTGTGTCAATGCGTAACGTTT
CCCAGTCCTTTTTCCTCACTATATCTCTATGTATTGTTTCATCTTCTACAAAAACCTCCCCGAGGCCAAGTCCATGAGCGAATCTCCCATGTGCAACACC
TCCAACTTGCACAGTTTCCCATTGAGAGTCGTGCACATGGTGATGGCTCCCCGCAGAGTCTCCAGTCCGCCACGTTGGACGCGCAACAGAGCCGTACTTG
GCTCGTAGCTATTGGAAGACTTTTTGTCGAAGGCCAGGACGTCAAACTCGCTTGCGGAAGCCCCCACCACACCAAACGCCGTCTTGAGAGTCGTGTCAAG
GCCGAATTTCAGCTGCTTTACGTCCGCCACAGGCTCGGAACCGTCTtcggagaagctgaaggtggaCAATAGATTAGATACTGGCAGTCTATGGTAGATG
ACAAGTGAGTCAGGGACGTACATGGCGATCTTGAGGTAGCTGTGCCCGCCATACAGCGAGAACTTGTGGTGCGGTGTCGGAGCAGAGGTTGTCATCG