Description :
From Genome Similarity Track
Location :
Scaffold_27:126244- 127641
Transcript NameFunction/comments
Aphas_H257_10715Hypothetical protein

Sequence
1397 bases(100 bases per row)
GTGCCCGTGGACGAATGGACCGTGACTGAGTCGACGCTGCTGCTCTCGGAGACCGATGCGGTCGCGCAGGTTTGTCCACGCCTTCCACTGTAGTATCATG
TCAATGTCTTAGAATGTGAATGAGTCGGTCGTGTTGCGCGCAGCGCTGGAGGGCGACACGGTGACCCTCCAGCGAGCAGCTGTAGTCTCTTCCTCCGAGG
CAAGTACATACCCAGCCTCGTTCTTACGTTAGTTGATCGACGACCGAGTAGACTACGTGCTTGGATGCGCTGGTGGAGGCGGTTGAAACCGGCCAGGACG
ACTCGACGCTGGAGCTGTTGAACCACTTGGGGGTCCCCATCAAGGGCAGCGGCGAGGTAAGTACTTCCGACAACCAAATCCCATTAGTCCCATTAGTACC
ATTCAGAATACTTGGAGTATTAGATTATGGAGGATCTTCTGGACATGCTAAAGCACTGAAGGCTCGTCCAAGTCCTCCAGCGTTCTTGAACTGATGAAAT
ATCCAAGTTCCTTTTTTGAATACACCACGATGGGAAATATATATATATTTATTTATTTATTGATTTATCTAGGAAGTCCGATAATACATATATATATATA
TAAGTATTTACCTAGAAAGTCACTACGTTGGAGAGGTATACCTCTGAGACCATGGCAGCGTTGCAAGCTGCGGTGACCGCTGGGCATGTGGAGAAGGTGC
TGACATTGCTACCTCGATGCGATCTTAACGACCATGATGAGGTAAAAATATATATATAGAAAATATTATGGATTTTATGGTAATATGACGAATACATAGG
AGACGTGGATGCTGCTCTGCAGCGCTAGCGATCGTGGCAACGTATTAAACCTCCTGCTTCAAGCACTCGATCTCAACAAAACACTCGAGGTACTGTACAC
GTACATATATACGTACATATATATATATATATATATTCTAGCACAATGATATAAATATATATGTGTATATACTAGTATTATAATATGCATATATAGGACG
GCTCGACACTCCTCCACCGAAGCAATTTCCAGTCAAAATGAACCGGTCGTGGAGTGGCTTCTGCGCCAGCAATCGATCGATGTCAACTACCCAAACAAGG
TGGATTTATATATATATATTTGTCAAGAACCAAAATATATATGATTTTTCTAGGACGGGAATACGCCTTTGTATGTAGCGTGTGACCTCATGCACTCGAC
GATCGTGTCGCTGCTACTCCGCCACCCGTTCATTGACCCCAACAAGCCATCTGGCAACGTATATATATAATTATATTATATATATATTATATCTTGATAT
TTGACATAATATTAGGACGGACGCACACCGCTGTACAATACGTTCTACAAGGCCGACGGGGAGACTGCAACTTTGTTATTGCAGCACCCATCAACCA