Description :
From Genome Similarity Track
Location :
Scaffold_16:126232- 129034
Sequence
2802 bases(100 bases per row)
TGGAAGCAAAAATATGACTATTACACGCAATTTGCAGAGTACTGGAAGGGTGACTTACTTCTTTCAACAGCGGTCATTGCGTACGCTTCATGCCTTACGC
GTTCGAGGCGCTTGTCGTTGCATCAACTATGGATGGAAGCTATTGCATCGCGTTCAGTGGTGGCTTCTCCCGTACGCCGACCCCTACACGAAGTACTCCA
AATCCGCGAAGAAGAACTCACAAAGATGTGTTTGAATGGGATAACGACAAATGATGAAAGTGCACTGGAAAATGCAGTCATTATCTTGCACAGTTATCGT
TTGCCTTTTCTCATTGATCCGTACAGTGCTGCTACGGACTGGCTTAAAAAACAACTAGGCTCAAGTAAACCTGCTATTGCCTCAGCCAGTAGCACCACTA
GTGATGCAGCAGTTTGGAAAGAAGTGGAGATGAGTATAAAGAGAGAAACTGCCCTAATTCTGACTGATATTTGCGAGGACCGTATGAAGGGCTTGCACTC
TTTTCTTGATGCCAAACGAAGAGCATTATTTGAAGCTATAAATCATGACGTCAGCCCTAGTGGTGGCGGCTATCGCTCTTGGTGTTATGCTCCTGATAAT
ATCGCGGACAATGCCGATCCACACGGAGTGACTCATGCCTCATCAAAAGCGAGAGACGGGATTCGTCAATTAGAGTCTCCGATCCAATTTAGTAGTGATG
CGTGTCGAGTTTTTATGATCTACACGGACACAAACGTCGCTCCAAGTTGGTTGTCAGCGTATCAGAGCCAAGTTACCATTGTTCAGTTTGAGCTGAGTGC
ACCTTTTGTGGAAGCACAGTCTCTGCAAAAACTGTTGGAGTCCCAAGGGCGTCTGCGTGAGTTGACTGAAATCCGAACACTACAACAGGAAATGTTGATC
TGTGAGGAACAAATCTTTGGGTTAGAGGAGGAGCTACTGGAATTTTTCAGTACCGAAAAACCCGAGCAGGTCTATTCCGAAAACTCCAAAACACTTCGGA
TCGTGGCCAACCGAAGTTCTGTGAACACACTACAGAGTTCAAAAGCTGAGGCTATAGCGAAGGTAAAGATGCACTGGGACAGCCTGGATAACTACCGAGC
TGTTGCGACGAGATGTTTAGATGCTGTTTGGGCGTGGCGTGAGTTCAATTTTGTAATTCGAGATACGGATAATGCGGCGGAGAAGACATTCCCGCTGGCA
TCGGTATGGCAGCTATTGATTCGAGCTGGTGAAGCAAGCAACAAAACGGATAATGATTTAGAGGTAGTAATGGCTTGCTTCACGAGCTACCTGCAGCAGT
GTGTCACCATGAATATTCGTGACGAAGACCGTCTCCTTTTCAGATTTCTGCTGGCTTTTCGTATATGGCAGCGACGCATGGTGGATGAAAGCTCACCGTC
ACCTCGTTTAGCGACATCTGAAAGTAGCGCACAAAGCTGGCGTTCCACTGACATGGAATTATTAGCACGTTTGCTAGCTTTGGTTAGCTGTAAATCTGTC
CACAATTCCCATGATACCTGCCGACCAACGCTGAAAAGTTTACTTGCACTTCGTCCTGCCGGCATGAAATCTATTGCTTGGTCTGCGGTCTGCTATTTAG
CAGAGGCATCTGGGGCTCTCCGACAATTTATCTCGAAAATGGAGAGTGTGGAAGCTGGGCAAATTGTGTGGAAATCGCTGCTCGAGCTGGGAACAAGTAG
TTCAGCTGATTGGGCTGTGCACATTTCCCTTGACGCCTTTACTCGTTTGTGTGTCGTTGTAGCTGTCCATCCGCATCGATTTTTGTGCGAGCTTGAGGAC
TTCGCCGAGCGAGAACTACAACGAATTTACAGTTTTCCCGCGACGTCAACACAATCAAGTACGAATATGAATCTATCGTCACTTTCTTCTGTGGTGGCCG
CAGCATCACACTCATCAATGACTCAAGCCCCCGACTGGCATCGTGATTTATTCTGCATGTGGCAAACATGTTCAAGTGCAAAAGCCCCGCTGGTAGTATT
TTGCCCACCAAACATTGATTTTATGGATGCGGTAACAAATGTGGCGAGGCGTGCTGGGGCAACGATGGATACGACAGACACTATCCAGCTACTGCTTGCC
GACGAATCCACTTTCAAGAAAATACTGCTACTAGCTATGGAGAAGGGTCAGTGGGTAGTACTTCCAAATGTACACACATGCCTCAACCAAATGGAGCAAG
TGAGCAGTATTTATGAATCATTGGACGATGGGCACGCTCACTCGGATTTCCGTTTATGGATATCAGTGTCAAAACAATCCGTTGAAGATCCTGCAAAGTG
GCAAGCTGATTTTGAAAACAGGAGGATTAATCGAATTGCTACACGACGAGAATGGGGAACTGGGTTTCTTTCATTAAAGCGGAGCCTACACCACACATTT
GCAATTTTGAAGCATGAGCTCGATGGTTTTGTATGTTCAAGCACCGTTCCAACGCTCCCTACCTTGACGTCAGCAGGTGCTTCGAGATTGAGTGAACACG
AAGAGAAAATCATGAAGCAACTCGGTGTTTTTCATGCACTTGTCTCGTGTCGTGACCATTTTCAATTTGCACAGTGGAAAGCAGAAGAAGAATTTGGGGA
TACAGAATTGTATGCTGCAATTCGCTCTTTAGTGGTTCTACGAACAGATGAAGAGACTGTAATGAAGGAACCGAGTCCTCTGTGTGCGCCCAGCATAGGA
ATGTGGAATGAAGTGACACTGCGTGGAGTTATCTCTAATGTCTATGGATCAACACTAGAATCACGGCAAGATCAACTGCTGGCTCAATCCTGTATTGATT
TT