Description :
From Genome Similarity Track
Location :
Scaffold_4:12623- 16530
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_4-fgenesh-gene-0.1Syntaxin 7
Pytap_DAOMBR444maker-pag1_scaffold_4-fgenesh-gene-0.17Conserved gene of unknown function

Sequence
3907 bases(100 bases per row)
GCACGCTCCATCTGGCAGCTCGGCGCCAGCGCATCAAGCCATCGCGGCGCATCCACGCCCTGGCGGCGGCACTCGGCGTTTGGCAGCATCCATGGGAGAC
CGCTACATGCGCGCCAGTTCGCCCcGCGGCGTGACGGATGAGCGCTACAGCAAGCTCGTGCAGGAGACGTCCAAGGGCATCTCGAGCTTCAACCAGCTCA
CGCGGTCCATGGCGCAGAAGATGTCGCTCTTTGGCACGCCGCAGGACTCGCGTGCGAACCACGAGCAGCTCAAGGAGCTCACGGAGAAGGGCAACAAGAT
TGTGAGCAAGATCAACAAGCGCATGATCGAACTGAACAAGGCCTGTCAAGGGCCACAGGCCCGCACGCGCAAGACGCAGGTCACCAAGCTCTCGAACGAC
TTCAAGAACCAGGTGCAGCAGTTTGAGACGACGTGCAATCGGCTCATGGAGTCGGAGCGGCGCAGCATTGACTTCATCCGGCGGTCTTCCCAGTCTTTCC
GTCATGACGATGATCTGCAGCAAAGCAAAAaGGACGGCGGCGGAGGCGGCGGTGGCGGTCTTGATCTGAACAACTACAACGAGGACCAGCTCTACGCACA
AGCCAACATCGTCCGGTACGACGAAGACGGTGCGTTACATGAGCTGTGGCGGTGGGAATATCGCCATGAGTTACTAAAGAGGGCAGTTGGCACGCAGACC
TCGCTCGCCGTGAGGAGGACATCATCCATATCAACCATCAGCTGCGCGAGGTCAATGCTGCGTTCCGTGAGATCGACGATCTCGTGCAGGAGCAGGGCGa
GACCATCGTCGAGATCGAAGAGAACACCGAGGTCGCGAAGGAGAACGTCAGCAAGGCACTGAACGAAGTGCGTCAGGCTGATGCGCGGCGCTCGTATTGC
GTCTGCTCTCGTACCAAGATGATATGCTACGGCGGCCTCGTGCTCATTCTTGTGCTCGTGCTcGTGaCTGTCATCagCCAGTTCTAACAaGCCTGCGTCG
TGTGTATCTAGAGCATGTATAGGGAGTAAGTATTGTAGAAGTAGAGCAAGCATGCCCAGTCTGTCGTGTGTACGTGTGACCCTAACAACTCTCTATCATT
CGTCTCTATCCTCACCCTTCGTTGGCGACGGGTCGAAGCTGTGCCCCCACTTCTGTGATCAGCTGTGATGCTCTTCGTTCGAGGCGCTCGGCTTTCTTCC
GTGCCTGGAATATGCTGCCGGCGACTGACATGATGATGCTCCCCACAGAGCTCGCACTGTGTCTTCGTCGATTCCGCTGGGGTGACGCACCGGAGACTTC
GGACCCATTGTCGTCTGCGTTTCCCGCAGCTACCCGTGAGGCACTGGAGGACCCAGAGCACGTCGGCTGACCGAGGGAGCGGAATCGGTTGCGGACGTCT
ACCGAGAACATGGACgAGAACTTGACATGTTCGTCGCGCTCGCTCGAGTCGAACACGACGATGCACGTACGCtCTTTCTCCCGCACTGCCTCcACCCAGC
CGTTGTAGTACTGCACACTTCCGTGCACGCGCGCCATCACAGCCTCGCCGACCGAGAACGCCACGGGCTGGATCTCAAaCCcAATGGTATCAAAaGTGTA
GTTGGTCAATTTTTGCGTCGGTGAGAGCGCGTCCGGGTCTTCGATGCTTGCGATCTTCTCTGGAGCCAATTGATCCTTCTGCTCACCGTAGTCAAAGACG
ATGGTGTACAGAGCGTGAGCCCcTTCCATGGTCTTCCCAATGACCTTGGCCGAGCAGTACCGCAAGAACCTCGAACTCCACGCGAGTACGATCTCGCCCA
CAGCTGCCTCATGACGGATTGGCGTCTTGTCAAGTGTCGCGTCCACCGCGCATTTGTCCACGATCATTTGCGACGGAAATACACCGAACGCGATCGTGCC
GTCGGCGAAGCGCAAGTCGCACGCTGAACTCTCGTGCTTGCGGATCACCACACAACTCTCGACCGATGCTCGTCGCGGGTGGTCGGCTTTGACTTGATAC
CCGACGTCCACTTGGAAGCCGTCCGCACTGctGTTGGCTTGCATGAGAACGGCGTTCTTGAGCGACAGCAAATCcAAGTCTTCTGTCtGGGATATgCGCT
tCCGCTTGGTGATTAGATTTGGTGGGATCTCGTATCCAGTCGATCCGTCGGCAAAGTCAACGGCTGCAGTATGGTTCGAGTACACACCATTGAGCACTCC
AAGTTTCTCTTCGATCTGACCTTCGTACTCGCCCTCGCACTTGACATACACTTGGTCGCCAATCTGGACCTTCACCTTGCCGCTGCACACCAGATACTGA
TCCTCTGTGATCCGTGGAGGTTCCTTCTTCTTCTCCTTTACGGGATTGAGCTTGTCGGCTGGAACGTTTATTAGACGAATGCGGTTCTGAAGCAGCACAT
GGAACATGCGTTGCCCACCCGCAGTGCTTGTGCGATTGGTGCCCGGTGAATCGTCATCGAGAGTGATCACCCCGGGGCCCGAGAAGCGCGTGCCAGGGTA
CAGGTTGACTTGAACTTTTCTTCCGACGTAGAGCTTCTTGCTTTGGTTTTGGAGATCTTCGATCTGCACTTCGAGCTCACGGATCGAGGGCAGGAAGTCG
AGGTCCTTGGCGGGAAAGACTTGGACGACGATTGTTTGCTCTCCTTCTGCCACAACCTCATAGTCGCCATTCGGCAGCTGTGACATCACTGTGCCGTACG
CTCGCACGCCGTCGCTCTCGCGCTGAAACACGACGCGAGTGTTCGTCGCGGGAGACACAGCGATGACCGAAGGAGACCCAGAAACGGATGGGGACGTGGA
TGCCATACTTGCAGTAGTCACCGTTGATCCTCCCGGCGAGAGAATCGACCCAATCGCAGTGACGGAAAACGACGCGgCGGTCATTAGCCCAGATGCCGAT
GCGGCTGATGCGCTTCGGTCACGACCACCGCTGCCGTGACTGCTTATCAGGAAGcTCCCGGTTGTTGAGCGTGCTCGCTGAAGTCGGGGTCCTGATGTCT
GCCTGGGTGATGGTGTTCCTCCGTGCACTGGAGTACTCGCACCTCCTCCGGAACCGCGACCCACACTGCCACCGATCAACACTGGTTGCTGTGAGAAAAG
TCTTCCTTCTCGTATTGCAAGCAGCTGGTCTTTCCGAGCCTCCATCGTTCGAACCACGTCGCTAACAGGGTCGCTGTTGGCAGTTGATGGCTGGACCTTC
TTGGTCTTCTTCGCGAGGTAATCTTGAATGGTCTGCTTGATGCCTTTGGGCGATGGGAGAATCTGGTTCATACtcTTCCCACTCACTGATAACCGCTCGA
TCTGTGAGAGTGACGACACGCTAGACCTCCGAGTCGACGCTCGTTGACGATGGTGCCGATGACCACCCCcTCcACCCATGAACGTCTGTGTCATCTGCTG
CCATGGCGTCATGGTCATATCTTCTTCGCTCGAGTCGTCTGAGTCGCTCACTTGGGtCgAGTCGTCTTCGTACGCAACTCCACACTCCAAGTGCTTTACA
TCAAGCCAAACaTCCTCCGCCACGTCGTATCCGGCTCGGCCCGCACTCACTTGCCTGGGCGgCGACACGGAGAAGTCGACCATGACGGGCTTGTCGCTTA
AGTGCACATCTGTTCGGTACCATGTGATGCGATGGTCGCTCGATGCTGTGACGTCTTGCTTGTCCTTGTCACTTGCATCGTCTTCCTCTTCATTTCCATC
TCCCTCGCTCACGGTGGACCGCATCGTCGACGCTGGCCGCAAGATGATGTCTTCACGTTTGACACGGTAATTCAAGGATCCGTCGTCAAAGACGATCATG
AACAGACCAGCGCCGAGATACGTGGCGATGTTGCCAGAATAAAAGTATGGGGTCTTCCTGTAGCGGGCAAGCACGGCCTGACCGTAGTGCCATTGGCCAC
GGAGTGG