Description :
From Genome Similarity Track
Location :
contig_59:126215- 129727
Transcript NameFunction/comments
g8979.t1multidrug resistance protein ABC superfamily
g8980.t1multidrug resistance protein ABC superfamily

Sequence
3512 bases(100 bases per row)
CGCCGTCGGACTTGTCGCGGCCTACCTGCAAGTGTACTGCTGGTCCCTCACGGCGTCGCGCCAGTCCAAGCGCATCCGCAGCCTCTACGTCAACGCGATC
ATCACCAAGGAGATCGGTTGGTTCGACGTGAACGACCCGATGCAGTTGTCTTCGCGTGTGACCGAAGCCACGATCACCATCCAGGACGGCATCGGGTCCA
AGATGAGCGACATGCTGCACTTCTCATCGACTGTGGTGGCGGGCATCGTCATCGGCCTAGTGAAAGGCTGGGAGCTCACTCTCATTCTGCTGGCTGTGAT
CCCGTTCGTCGCCGTCAGTGGCATGGTGGCGAAGAAAGTCATTGTCGCCGCTACTCACAGCGGCATGCAGTCATACGCGCAGGCAGGTGCCGTGGCGCAA
GAGTCGCTCAGCAACATCCGCACGGTGCACATGTTCAACTCTGTGGGGTACTTCGTTGAAAAGTACAGCCGTGCGCTCGAGGGCGCCACGCGCGCTGGGA
TCAAGAAGTCTTTTGCTGTTGGCTGGGGCAGCGGACTCATGTACATGATGATTTTCCTGATGTACGCGCTGGGATTCTTTATCGGAGCTGTGTTTGTCGC
TCGCGACAACTTGGACGGTAACTCGTGCACAGGATCAAGTTGCTACGACGGTGGCCGTGTCTTGACAGTATTCTTCGCAGTCTTGCAAGGTGCGATGGCA
CTGGGCCAGGCAGGACCCAATCTCCAAGCTGTTTTCTCCGCATGCGCTGCTGCCTTCGATGTGTTTGAGTTGATCAAGCGTCCGTCACTGATCGACCCCA
CCAACGACACACAAGGCAAGACACTCAACACGGTCTCTGGAAGCATCGACATTGACAACGTGCGGTTCGCCTACCCGTCTCGTCCCGAGGTGGAGGTGTG
TCGCGGGTACTCACTCCAGATTAAGGCTGGCGAGACGGTGGCGCTAGTTGGTCCGAGTGGCAGCGGCAAGAGTACGGTGATCTCGTTGCTGGAGCGCTTC
TACGACCCGCTCGGGGGCTCCGTGAAGATCGACGGCGAGGACGTCCGCACACTGAACGTGAAGTGGCTGCGCCAGCAGATCGGTTTGGTGGGCCAGGAGC
CGGTGTTGTTTGCGACGTCAATCATGGAGAACATTCGCCACGGCCGGCCGGGAGCGTCGGATGGTGAGGTCGTGGAGGCCGCCAAGATGGCGAACGCCTT
CAACTTTATCATGGAGTTCCCCGAGGGGTTTGCGACCGAGGTGGGCGAGCGCGGCGCACAGTTGTCGGGAGGTCAAAAGCAGCGTATTGCCATCGCGCGA
GCCATCATCAAGAACCCGCCGATTCTGCTGCTGGACGAGGCGACGAGTGCGCTGGACACGGAGAGCGAGCGCATCGTCCAGACGTCGCTGGATCGGTTGG
TGGCACGGTCGAATCGCACGACGATCATTGTGGCCCACCGGTTGTCGACTATCCGAGACGCAGACCGCATCGCCGTGCACAGTGGCGGTCAGATCGTGGA
GCTTGGCTCTCACGACGAGCTCGTGCGTATTCCCGACGGTCACTACCGGCTTCTTCTTCAAGCTCAATCGCAGCCATCTGCTGAGGAAAAGGCTATAGGA
GCCGACAAATCGATGATGGTAGACGTACCGACCGAGATCGATCGGAAAAGCTCACAACCGGTGCAGTCTGCCAGAGCGTCTAGCAAGTCCAGTGGACCGG
CAATGGGAGCCGACACCTCAAGTGAAATCAACGACAGTGAATCCGGTTCCACCGAGAACACCTCGAAAGTCTCCACGTCGCGCATCTGGAAAATGGGTCT
ACCTGAGTGGAAGTTCATGGCGTTGGGTGGAGTATCCTCCGTGTTTAAAGGCGCCGTCTACCCGCTGGCTGGCATGTTCATCGCCAAGATCATTCACTTA
TACTTCGAGCTCCAGAAGACGAAACACGAGTTGCTCCACGACATGCGCTACTACTCTCTGGCGCTGGGTTGTCTGGCCATCGTCTGTGGCGCGTCTTTCA
CGCTGACGGAATATTGGTTCGGTATAGCTTCGAGTCGGTTGGTCACTCGGGTCCGTCTTGCGACGTACAGCGCTATGCTGCGTCAAGAGGCGGGGTGGTT
CGACCACAAGGAGAACTCGTCGGGCTCCCTTGTGTCGCGTCTAGCTACCGATTCCGCTATCCTGCAGTCGATGACGTCCGATTTTCTCAACCGCAGTTTG
ATGACTGGCACGACGTTTATCATCATCTTCGCCATCTCGTTCTACTACAGTTGGGAGATGACTCTCATCATGATCGTGACGACCCCATTTCTGGTGGGGG
TGAACTTTGTGCGCTTGCAGCAAATGTCTGGCCAGATGAACGCGAAGGAAGAACAACCACGCTGACGCCGCCGCGGGGTCTCTTTTGTCGGAAGCCATCG
ACTCCATTCGCACGGTGGCGTCATTTGGAATGGAGAAGTCTCTCACTCAGCAATACGCGGCGTTCTTGGACATCTCGAATGATCAAGACAAGAAGCTGAG
CGTGTCGGAGGGGTTTCTTTCGGGCTATCGCAATGTATGATGTTCTGGGTCCTGGCCTTTGTTTTCCACATCGGCGGGATCTTGGTCTCGCACGGCACGA
TTAGCTTCGAGGATCTCTTCGTCGTCCTCATGGTCTTCATGATGGGCTCTTTCAGTGTCAGCATGGCCTCACAGGGATCCGTTGACGGCGACAAGGCGAA
ACGAGCTGCCGCCGACGTCTTCAAGATCATCGACCGCGTGCCGGAGATTGACGCCACGTCCACAGCAGGCATCGTGCTACCCAGTATCCAGGGCGACATC
GACTTCAAGCAACTCACGTTCGCGTATCCGTCGCGGCCGGACGCCGTCATCTACCAGGGCTACGACCTGTCCGTTGGCCGCGGTCAGACTGTGGCGCTGG
GGCGCGAGCGGCAGCGGCAAGAGCACAGCCATCGCGCTGCTGGAGCGGTTCTACGATCCGTCGTCGGGCCTGGTGACGCTGGACGGCCACGACGTGCGCA
GTCTCAGTCTGCCGTGGCTGCGCGACCGCATCTCGCTGGTGAGTCAGGAGCCGGTGCTCTTCTCGGGGACGATCGCCGAGAACATCGCTCTGGGCAAACC
CGGCGCGAGTCGAGCGGAGGTGGAGGCGGCGGCCAAAAGCGCGAACGCCTTCGACTTCATCTCGAACTTCCCGCGGGGCTTCGACACGGAGGTGGGCGAC
CGCGGCGCGCAGGTGTCGGGCGGCCAGAAGCAGCGCATCGCCATTGCGCGCGCTATCCTGCGTGACCCGGACGTGCTGCTGCTGGACGAGGCGACGAGTG
CGCTGGACAACGAGAGCGAGCACATTGTGCAGGCCTCGCTGGACGCACTCATGACGCAGAAGCGGCGCACGACGATCGTGGTGGCGCACCGCTTGTCCAC
GATTCGGAAGGCGGATGCGATCGCTGTGACGCGAGAGGGAGCCATCGTGGAGCTGGGCAGCCACGAGGAGCTCATGCGGTTGCCGGGTGGGGTCTACCGC
GGGATGGTGGAG