Description :
From Genome Similarity Track
Location :
Scaffold_1719:1262- 2828
Transcript NameFunction/comments
Physo_126853hypothetical protein

Sequence
1566 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGACACGT
ACGAGAAACCCGTGGAGCCGGCAGCCTTCTTCGCTTTCTTGTTCTTATCAAGAACCTCGTTCAACTTGTCCCATCGTCTCTTGCGACTCGGGTGCGGTGC
AATTTCAGCGTCCTGGACTTCAAGGCACTCCCGATCTGCAACCACCAGCACGTGAATCGTCTTCTTCGTTGGAGCACCTTCAAACACGTCGCCAATCTCA
TCTGCTGGGTCCATTTCCACGTTCAGCAGTGTCTTCACTTGTTCAGGAATGCCTCCACTTCGCATAGAAATCACATCAGGGTCCTTCGATGAGAGCCACG
CGCCGTCCGCCGTCTTCGCCAGGAAGAGCTGCAGCTTGTCTGCGTCGACGTCCTTGAAGTCGTTCGGCTTCTCCGCCTTGATTGCCTTCTTCAAGTGGCC
CACCAACTTGTTCTCGTCAATGTCCACAGGGATTGCGCTGCCCGCGGCACCAACGACAGCACAGCTAAGCGTCATCATCTTTCCTCGAGCCGGGAAATTC
TGGAATGAGGAAGAATTTCTGGCGTACTTAAGCGAACATGAAGGTGTGTGACATAGATTTTCAACC