Description :
From Genome Similarity Track
Location :
Scaffold_130:1262- 2339
Transcript NameFunction/comments
Aphas_H257_17936chromodomain protein, putative

Sequence
1077 bases(100 bases per row)
CGAAATGAAGGCCTACACATCGACTTCCCATTTATGGGCGAAGCGTGGCGAGTACCGAAGTACGTCCTGGTCCTTAAAGACGACTTGACCCATTACTGCC
GCCTCATTGCATGCGTTAGCCCGACAAGCCAAGTTGCAGTTGAAGCCATTATGGAATGGTCGGCGTTATTTGGAGTCCCTGAAGTCAGGATCTCAGACGG
CGGAAGCCATTTCAAGAACTCCGCCATGAAGGAACTTGCGACGCGCCTACGAGTGCAGCACAACTTAGTGCTTGCATACTGCCCATGACGCAACGGGACG
GTCGAACGAGTCAACCGCGACATCTTGGGACTCATGCGAATCATGCTGAGAGAAACAAAACTCAAGGAAACAGAATGGGATTTTCTGTTACCGGTTGTAC
AAGCCAACATCAACCAATCGCTGGTGGCGACGCTGGACCACACAAGCCCCATGGAATGCTTCACAGGCTTGGAGTCGACCACAGCGCTCAACACCATCGT
TGGCAAAGTCAACCCGCGATTATCGAAGACCGGATTCCACACGATCGACTGAAAACAGAAGAAACTACGGCAAGCTGTGGAGGAACTACAAGAAGTTCAC
TCAACAATCGTCGACAAACGGTGCGCCGCCGAAAACAAGCGAATGCTTGAGAAGGTAAACCAAAACGAAATGAATGTCACAGAAGGAGACTTTGTGCTTT
GGTCCCGCGTGGATAAGAACACACACAACCCCAAGCTACTGGCCACGTGGATTCGCCCCTTCCGAGTCCTCAAGTGCCTGCTCTACTCATGTGTCATAGA
ACAATTGATTACGGGTGTACAGCGCGAAGCACATCAGTCACGACTCAAGTTCTACGAGGAAAACCACTTTCAGGTTACTGAAGTAATTATCGACCACGTC
AGTGAGCAAGGGACCACACTGGTTGTTGACCCAATCGAATACGCAAGGCGCAACCCTGGTTCTAACCAATGGGAATTACTAATCCGATGGAAAGGCCTAG
AGAGCCTCGAAGCAAGCTGGGAACAGCTCCCGGCGATGCGCCAGGAGGTCTCATCTTTGGTGCAGTCGTTTGCCGAC