Description :
From Genome Similarity Track
Location :
Scaffold_244:12619- 15204
Transcript NameFunction/comments
Phypl_g5851hypothetical protein PHYSODRAFT_503646

Sequence
2585 bases(100 bases per row)
CCACTTGCTCACAAGTCGCTCGATGGCcatgtcctcgtccgagaggAAGATCATCCCCATGCGCGAGATTGTAGCAGGCGATGCGAAGCGCAGGTCGTGC
GTCTCGAATACAAAGTTGACGTTCGGGCCGAAGTTGATGCGCTCGCCGTTCGGGAGCGTGAGCAGGTggttgtcgtccagcaccgagttGAGCGACTCGA
TCCACTCCGggtccacgtcgccgtcacAAATGATCCACGAGCGAACATTCTCAGGCTCTTTGACGACTTGTCGAGCCGCGGCAGTAAGCACACCGTCCTC
CCATTCACGCGTGTCCAGGTCCATGTGCCCCAGTAAACGCTCTCGCGGCATCGACTTGGGATTCATCACGTGCGTCTTGACGAGCTGGCCGCATCTGATC
AAAGCTTGCTGCAGAACCTGCCACACCGTGGACTTGCCACTACCTGAGGGCCCCACGACCACGCAGCCCATGCGCTGGTCAAGCGATTCCTTGAGCTGCA
ACATCTTGCggatctgcagctcgtccacttGCAGGAAGAACGGTTTGCTAGTCATGACGTCGTGAATGGCGTCGCCCAAAGCACCACCCGCTAGGTCAGC
GGACTCCACGCCCGGGAACACGTCTCCGATCAAGGCCAAGAACCGAGTCGAATCCACGAACGTGAGCTTGGAAAGCGTGTTGATGCGCACCGCCTTGATG
AGGATCTCAGTTTCTTCcgccgtcgtcatcctcgCGGGTTTGCTGTCTGCAGACTtgccttcctcttctccgCTCGGTGGTTTCCCAGCATTCGTCGCGC
GCTCCTTCTTTTCTGTCTGCAGGAGCTTCCCTGCCGTGTTCAGGACAGCCTTCAGGGCACGCAGACCCCAGTCGtagtgctgctgtcgcgacAACAATTG
CCCAGACAGCGAATACAAGGAAACAACCTTTGATGCGATGTCTTTCGCCTCGCTGAACCCCTCCGAGTAGAGGATCACCTCTGCGATGAGGTTGTTGTCC
GGTCGGCCCATCGCAACGGGACGGAAGAGCGCCTTGAGGTTGTCGGGAAGCTTCGAGCGTCCGCCGTAGCCCTTTCCAGCAGGGTTGAGCGTCACGAAGA
TGCCGGCGTTgaagtccacgtccacggagCGGTTCAAGAGGTTGATCGTCCCCGTTTTCTCCTTGATGGCGTCTTGGATGACCTGAATCTGCTGAGAAAT
GGCCGAAAGCTGGTCCTCCTTCAGGCGattgaactcgtcgaagcAGCCCCAGGCTCCGCACTTGACGAGACCGATGAAAATGCGCCCCATGGACTGGAAG
TCGATGCCTTCATCGCAGTTAAACACCAGCACTTGTCGTCCGAATTGTCCGCCCAAGGCCTTCACGGACTCGGTCTTGCCTGTACCTGCAGGTCCGTATG
GGTTGCCACCGAAGCCCATGTGCATACCCTGCGTCAGCGTTAGGTAGCACTTGTCCGTTAGTGGCGTGTGGACCAACTTGGGTGCATTGCCCTGGTACTC
GTACGTGTAGGCAAACTCCGCGTCGTTCATCCGAATCAAGCATGGCGGTGGGTCTTTGCCTGCCTTCCGAGTGTCCAGGTAGAAGCGAAGCTGCTTTTGC
CAGATCCAGTCGCTCACAGAGCGACAATTAGCAGCTAAGAGCTGATCGCACACGTCGATGTGGTGCACGAGGTCTagcacgagcgccttgaCCTTGAGAC
tcatgagcagctccgtaCTCAAGTCCAAGGACGTCAGTTCTCGCAGCGTGTCCTGTAAActgcgcttgagctcttgAACGCCTCCGCTTTTGACGGCCGC
TTCCGCTTGAGAGCAGAATCGGATCTGCTCGGCAAGACACAGCACTTGCGACGGGAACGCGTGGTAGTCTGGAGCACTAGCGCTCACACACTGGGCTGTG
AGTGCACGAATGGTACGCCGCATCTCTTCCGTGAAGGTTTCCAGCCATTCCTCGACGTTGATCGTGATAGCTACCGGTGTGTGaagctccacgcgctcgc
cggcAGCACTCAACATGGCCACGATTTGGTCTTTCTTGTCCGAAAACTCGACGCGGTACACACCTTGGTAGAGCTTTTTGAGGTGGCTCTGGATCACGGC
GGGGTTTTGAGCCTGCCCCAGAATCTCCAGCAGGTCTTCGTCGCCAATGAAGTAGAACCGCGGCATGCGCGagcgcttctcctccaagAAATCGGCCAGC
GCCTTTTGGCaccgctcgagctggtcgaccATTGTTGTGAGACGCTCTACCAGCTGAGGGAACATCAGTTCATCCGCAAGGTTGAAGAGCTTCGGGTCTC
GTTCGACCGCGCCCATAATGTCTGTGAACTCTTCATCCACGCGACGGAAGCGACTCTGCTCGGAAGGCAACGCTCCTTTCGAGAAAATGGGCTCGAGGAA
AACCCACTTGCGCTGAATAACGttgagctgcgtcagcactTGGTCGAGCGTGCTCATCTTGATCTCGTATTGACTCGCTTCGACCTCGAACGGCTTGAAG
AACTGCGATTCCTTGagcgaggccagcagcgactggtTGTCGCCCAACGCGAGGGTCAAGTCCTTCCAGTCTTTGATGATGGCCA