Description :
From Genome Similarity Track
Location :
contig_30:126155- 159709
Transcript NameFunction/comments
g6533.t1hypothetical protein
g6534.t1XP_008895330.1 hypothetical protein, variant 2 [Phytophthora parasitica INRA-310
g6535.t1hypothetical protein
g6536.t1hypothetical protein
g6537.t1hypothetical protein
g6538.t1hypothetical protein
g6539.t1hypothetical protein
g6540.t1XP_009538757.1 hypothetical protein PHYSODRAFT_307593 [Phytophthora sojae
g6541.t1hypothetical protein
g6542.t1ETL32185.1 hypothetical protein L916_15179 [Phytophthora parasitica
g6543.t1hypothetical protein

Sequence
33554 bases(100 bases per row)
CGACGAGCAGAACGCAAAGTGAAAATGTGGCAACAGAACAGTCAATCAATGAATAAATACATTCCAGCGAAGTTTCATCAACCTCATCAACTCAACCAAC
GCTGGCGCGTGGAGGCTTATCTCCATTGAGCCCCCTCGATTTCTGCAAAAACCTCCTAGCAGCTGCCTGGGCAACTGGACTCGACAGCAGTGACACACCA
GCACCGCTAGCACGGCCCTCTTCACGGTCACCTGAGCGCAAGTCGCGTAGTAGCTCTCCGAACCCGCGTCCGTAGCTTAAGTCACTCGAGAAGACGTACG
CCCGCCCCTCTCGTTCGAACAGCCTGCCCAGCGTAGAATCCACGCCTCGGGGCCGCTTCGAAAAATATATTGGCACAATCGTCTTGCCCTTGTCTTCAGC
AAACGCCAACTGGTCACTCACCAGCTCCGTCTTCACACTTCGCTCCGAAAGCACGACCAGGAAAACCGAGCTCTGCAGGATAGCATCCTTCGCTGCCAAG
ATGCGCTCCTTGGTGCTGGAGACATTAGTCATTGAATCCACCACAAACGGCAATTGATGACGACGCAGCTCCGTGCACAAGCGCGTCACAAAGTCGCGAT
GGCAATCGCCGTGCGATACGAAGATCGAGAATGTAGGACCTCCTCCAAACGTACTCCGCCTCCCACTACCGCGCACGACCACGGCATTCACTATATCATC
CAACCGACGATGCTTGAGCGTTGAAGTCCTTACTATTGGTTGCGTGTACCTACTTGCCATCGTTTGAGCAAGTTCTCGACTGCCTTCCAACCGATGCATC
TCAACCTCGTCACGCAATCCGTCAATGAGACTTCTGAGGCTAGCCTGAAACTTGTCCTCATCAATTTCAAACTTCAAACGGTCCATGGACGATGAATCCG
ACGAGGTAGAACTGTTGTCGCTAACTTCTGGTATTTTGGCATGACTGGAAGTCACGGCCTGGCCGAAAGGCACAATCTGTCGCGTGAAAACAAATACCTG
CAACTCTTCAGACATTTTGACGGCTTCACACGATATTGGCACCACCGGTACTTCGTGCTGCTTAGCAAATGCAAGCTCATCCATACACAGTATGCTCTGC
GCATACCCATTTGTGAGCATGCACACGATAGCAGAAGCGTTCTTCATCACCCCCAGCGATTCTTCTGATGCACCACCACCCTCGTTACCCACAGCATCTT
CGTGTTCATCGCGCATATACACTGTCATGAAGTTTTGTTCAATACCAGCCTTTACACGCTCAGCAAAACCGCCAAACACCGGGTCGAATGATAACACAAC
ATCGACACAACCACCTGCGATCTTGACTACGTACTGTAGTTCAGCCGACGCGCAGCACTCGATAGCCCGACGTCCATCCCCATTCAGCGCGTACAGGTCA
GCTTTACCTTCGACTAGTAGAGACAGCGCAGTCTCCTTATAACCGAGCCGCAATGCAATGTGGAGAGGAGTCTCCTCCATTTCATTTGGGACAAGTTCAC
TGACATCCGCGCCAAAACGGACAAAGAGTTCTACGCAATCTCCTCGAAGTAGACCCCCTTCCACAGCAAACGCTAGCGGGGTCATTCCGTCATGGTCCAA
TTGCAAATAGTCTGCATCCACAGCGAGGAGCTCCTCTACTGCTCCAGGATAGTTGTGGCGAGCTGCCCAGTGCAGAGGTGTCCGTCCATAACTGTCCTTA
GCATTGACATCAGCACCGTGTTTCACAAGTTCACTGATGACACGCTGTCTTCCCATCACAGCAGCCCAGTGAAGAGGCGTACGACTGTGGGCGCCTCGCT
GAAACTCGCCTAAAACATCTGGGCTAATGCCCCACGACAGCAAATGGTTCACGGCAGCAAGGTTTCCTGCAGCGGATGTTTCGTGCAGCGGGGTGAGCGC
AACATCAGCTCCCCATTCCTCTAGCACTGCGGCCAGCTCGCGACGGCCCGATAACTGCGCTCGTTGAAGCACAGTCGTGCTGGCAGCGTTACCAGACCCC
GGAACTAACAGAATGTTGGCTCCGTGCCTGATGAGACTTTCAACGACGTCGGCTGAGTCAGCTAAGAAAATCGGGGTGACACGCATCGAACGAGAGAAAA
AGCTGGACCGCGCAATGATGTCCAAGTTGGCCCCATGCTTCACCAGGAGATCAATGACCTGCGTGTGGCCGTGCAAAGCGGCCACATGCAGAGGTGCTCC
CAGTATATGCGTCACTTTCTTCACTCGCAGCTGACACAGCTCGTACAGCAGCTCCAAATTAAACGTGGCGCCAGATATTTTATCGAGAAAGTTCGGGTTC
AGCCCTGCTTCAAGTAGCACCGAAACGACTCGAACATCGCCAGCTCGACACGCCACGTGCAGAGGGTTCTGCGTTCGATGCGAGAACATCCAACATACCA
GTGACGGCGTAGTGTACATTCGATTGAGCAGCATATCCAGCTGCACCTTGGATCCGAGTACGTGTTCAGCGCGCTCCAGCAGTTTCTCCACGGCTGCACA
ATTTCCGCTCGCTGCAGCGTCGTACAGCGCGCCACGCAGCTGCCTCTCGACCGTGCGCACGGTACTCGGCGTCGTGGCCCACGGATGCAGTTCCTGGTTC
AGCGTCAGGTACGTATCCACATGGTTTGCCTGGAGAATGGGTGTGTTGACTCCATTGGGAGCGGAGTTTCTATCGTCACTTCCGGCAGTAGCATTCCCCC
CGGCCAGTGCCGTCGGAGCCACTGCCATCAACTCATCTTCTTCCAGCCCGGCTCCAAGCTGCAACTGCTGATGGGCGCGCAGCTTGTCGAACTGCTGAGT
ATGCAGCGCGATGGTGAGAATGGCCAGCAGCGTCACATACGACACAGGGTCCGTCCAAATGGCCCACACGCCTTCCTCCGTGAGGTCTCCGAAGGCCCAG
TACACGCCCAGCATGAGTACGACGATCCACGTGAGAGAGACCGTTTGCACCACCACAATAGCTTCGAACACGGCCAGCGTCAGTGTGCGCTCCAGCGTCA
CGCCAGGCCCATCGAATGCTGAGCGGGTGAGCGAGAAGGAGCTCACGGCGCGCGAGCCCAGCAGCTGCTCGCTCGTGGTGGCTGCGGTCGTAGACATCTC
CACAATCGGCTTTTCGGCCTCGTGAACGCGGTAGAGCGGCACGAAGGGCATCGCCGCCAGCCCCAGCGACACGTTGAGCGCCTGCAGACCGAGCCAAGTG
TCCAGCACGAAGCCCTGCTTGCTGGAGAACCAAAGCAGCAGCAGTGAGCCCAGCGACAGCAACGACGTGCAGGCCACGCGCCACGTGTAGTAGGAATTGG
ACCACTGCAGGTAGGCGTCAGCGCCGCGCCAGCCCCCGCGAGCAGGAGGCGTCGCGTTGGAAGCCATCGCGTGTCGGAATGATGCTCAACTCATCGAAAT
CCTGTGAACACGCATAAAAGGTAGTAAATGCGAATTTGAGAGGGGATGACAAATTCCGACCAATAAGAGAAGAGCAGCTGCCAACGGGTCGAATTCCAAT
GCATTTGAATAAGACTGGCTTGTGTTTTGTATGGGATTTCTCGGACGAACGCGGTGGACTATGTCAAGCCATGTGTGCCATTGCTATATGTATTATGTGC
TCATCAAAAATACGTTAGATGACCACTACGCTCCACGCGATCCTTCGGAGAATGCTTGGTAAACACGCACCATACTCACATGTCCCGAAACGAAACCGCC
CACGATTGGTGGGATATTTAGCCAATCGCAGTCGGCTAAAATCAGCCCGACCTGTCTGACGAAAGCAGCCAGAAACTCCGCAACACAGACAATTCCCACT
GTAGCAAAGCTTGAGAGACATTTTCCGGCATACAAAAGGCGGTCGTTCAACCAATCAACCGAACGTCCGAACGCGACTTTCACAAGGAAGAAAGCAGGAC
CAGAAGGAGCGCACACGTTGCACGCGCAGCGCTCTGTCGGACCGTCGACAGCGCCAGACCGCAGGGGCTAACAGCAGCAACAGGCGCAGCACACGTAGAT
CTCCGTTTGAGCTGCTCGCACCGACAGCAGACCCGTAAAGCAGCAGGAACAGGTGGACAGGCAGGTCATGGCCAAACGCATTCGAGTGACCAAGCCGGAC
GCGCCCGTGGGCTTCGTAGACGTCGCCACGACGTCCCCAGTGCTGATCAACACTGCGCCCAAGGGAAAGGCCCCCACACCTACGAACGCCGAGGGGAAGC
ACGTGATGCTGCCCGCGTTCCTGTCCAAGACGTACGAAATCTTCAGTATGCCCGAGTTCTCGCACGTGTGCGGCTGGAATGCCAACGGAGATACCATCAT
CGTGTCGCAGCTTGAGGCCTTCGTGGCTATGGTGCTGCCGCGCTTCTTCAAGCACCGCAACTTCCCGTCTTTCGTGCGCCAGCTCAACCTCTACGGCTTC
CACAAGACGGTGCTGGATTCAAAGCGGCTAGAGTTCAACACCCGTACTTTAAGCGCGGGCGGCCGGACCTGCTGCACCACATCAAGCGTAAGGTTTCCAA
CAGCAGCCACCACAACCAGCAGCTCGTGAGCACGTCGATTCAGGTGGGTTGATTGGCGACATGCGATCGATTCGTTGGGTGATGTTCTAATGTCTGTTGA
GTATTTTGAGCAGAACTCGCGACTTGATGCTCATCGGGAGATTTCCGACACGCTGCTGCGGGAGATGAAGGAGCTGCGGCAGCGCAGCGACGCCATGGAG
AAGCGTCTGCGTGACCTGGAGATTGATAACGCGGTACGGGCGGCCGGTTCCAGAATATTAGACAGTGTAGCTATTGCAGGGGCTGATTATTTTTTTGCTG
CGATAACAGATTGTGCGGAGCGACAACGTGAAGTTGTGGAAGCACCTCGAGTCAGCGAAGGACAAGCAGCTCATTATGCAGGAGAAGATGAAGAAAATCA
TGTGGATTCTGTTTCAGATCTACCGAGGAAAGCAGCAGAATCTCCCCAAACTTTCTGGCAACGACGTTGCGGGTGCTGTTGTCAGCGAAGAGTAAGTGCC
GAAGGCGTGTTTCTGCCAAATGGAGTATGCAATATGTGACTAACCAGTTTTTGCTGCTGTGTGGTGTTTGCATTTCGCGCCTGCTAAACGTTGGCTTCGA
ACTACCAGTATGCTTGGACCAAAGGAATTCCGTGATGTGTTACGTTTCTTGGCGATGGATGACCCCCCTTTGTTGCCTGGGTCCTCGGCGAATGTAGCCA
CAGCTACGCCAAGCTCTCGGAAGCGTAAATTTGTCGAGGTGCCATCGGATGTTGGCGACAGCTATAAACTAGGTACAGTTGAAGACGCCTTGTGATCGAT
CAAATTTGTTGTACTCACTTGATACTGTTTATTTTCAGATGTAGAACCATCTTCTGTCGTCGAGGTACCGAGCGAGGTGGAAGATCTCAACCCCTTTGCC
ATGACTGTTCCTTCCAACAAGCTTCCTGTGCACACCAAGATGGAGGGCAGAACAACATCCTAAGCATTTTCTCCCCGATCAATGCGATGAACAACAGTGT
GCCCAGCATTGACCCAATGCTCGGTGGATTCCTCACAAATGGTGTGGAGACGGTGCCTAGCATTTCACAAACAAGCGCATCTGCACCGACTGCATCGACA
CCGATTGAAGCGGCCCCTGCTGGATCGGCATCAACCGTATCAACCCCGGATGAAGGCGCACCTGTTGCCAGCAACAGGGACTGTACTCCAAGTGACTCCA
CGGTCGCGTCGAATGGTACTGCCACAGAGCCGTCGGCGGATGCAAACAATCAGCTGGCTTTTTTGGACGAAGAGCTGCCTCTGCTGCCTGACTCTCACTA
CAACTTCACCGACGGCGAACAGGTACTGTAACACATCCTGTGGTTATGGTTGTTTGCATGATTACCTTTTTGTGGATCACTGTGTAATGGGGTGTCTTGT
TTTGGACTGCGCATTAGCAGGCAGTGATGAAGAAGCTCGAGGATTTCGAGACGTCACTACTGGACGAATACGACGTCAGCTGCCTCGACACGTTGCTACA
GGTGGGTTCTAATAGGTTTTGTGTATGTGATTTTCTCTGGGAGAACATTTACTTAATCTGCTTCTGTTCTTCATTGTTGTTTTTACGAACAGCAACTGAA
AAGCTCTGGTAGCGGCGACAAATCAGCCAGTGTTTCAGTGGCAGATCCGGAGGAGGTTGTGGTGGGACCAACCAACGCGACCCCACACGATGCGTAATGG
AGACTTATTGCGGACCAAAGTCAGCTACCATTGCGACAGTGCTCATGCTCGGAAGCTGGTGGTGGTGATTGCGAGCACCGCCTCATCGAAGAAGTTACAT
ATCCACGTACATGTCAAGCGAGTTGCCGCGTGCGCGTGTCGTCACTGGTAGGAGTTGCCCAGCGCTGCAGCGATGCATGCGTGTCACTACTCTTATCGAC
TGATAGACAAGCGATTGAACACGTCGACTCGCGTCTCCTCGCCCGGTATAGAAACAGATCGAGTGTCAAAAAGTCAAGAGAAGATCAAGCGGAGCGAGAT
CGCGACGCGAAACCAAGAGAAACGGAGACGAGTTCGTACGAACAAACAGCCAACAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCTCCGAAA
CGATGACGAACCCATACATGCGGCTGTTTTTATTTATGCGCAAGAAGCGAGAATCGAGACAACCTAAAACGAGAACAAGAAAAATGGCTCTTCATGTTGT
ACTACTGGACTTCATCCTCTAGGTGTTGGTTCTTGGCGGCGACTAGTAGCTTTATGCCCTTCTAGTTCACTGCGAAGCCGTTGGATCTCTTTGTCCTTCC
GGCTCAGCTCCAGTTGCGCCGTAACGAAGAGAGTTGAGATGTTGGTCTCCAGTTGCTTGTTGGCGGCACCGAGCTGTCGGTTCTGCTCCTGCAATTGCGC
GAGCTCATCTCTAAGTCGCGAGTTCTCCTTCTCCACTTGAGTCTTGAGATCCAGCGCCTCCTTCTTCTCCAACGCGCTCGTGGACGTGTCTAGGTCCCCG
TACAAGTCCTCCGTGCTCATTGTCGCCAATTCGCTAGTGATGCATACAAACTCCCAGCTACAACGCGTCGGATTTAGTCGGAAACCGGTCAATTGAGACC
ATGGACTCGCGGTGCATCAAGTTCTGGGAGGATGGTCAGGTGCTGGTGGCCGCCATCTCCGGCGCGGCACGGGTGGACCAGACGCAGGGCAAGATTTTCA
AGGAGCTGCGAACCATGAGTCGCTTTGTGCAGCGCAACCAGAGCCAGCGCTTCAGCGACGCGGCGCAGCAGAAGCTCGTGGACTGTGTGGGGCACTACGT
GGGACTGGGCAAGCAGGGAGGCGCCATGCTGCCAGTGGCAGAAGCCACGTTTCAAACTGTGAAGGATGGTTTGGCCATGCCGTTCAACGTGTTTGGCACC
AAGCACAAGAAGCGGTTGCTCAAATGGTACAACGAACTTATTACCATCGTAGGCGGAGACGCGGACGCGGCAATTGCTGGAGAAGCTGCCAAGCCGAACA
TCGAGTGGGGCGTCATGGACATTGACGAGGACGGGTTCCTGTCACTCATGCAGGTAGAAAGCGGAGACACAAACGAGAGCTTCCAGGTACAAAAGAAGAG
CGAAGAGTACAAACAGATCAAAAAGGCGCTGGAGAACAACGAAGTTACGGTCGTCACCAACGGCGACGACATCGTGGACATACGCGTTGAAGGAGACTAG
ATGGAAGAAAGCTTCCTACTTGCATGGTAGAGCATAATTAAGAGTAGTCAAAATGCGTCGAACGTTGATCCCATCTGACGTTGTGCTTACGGTGTGATGT
TGCACAGTTAAAACGGACTGGCAGCACCAGTCTTGTCGCGACTCTCACTCCACGCCTTGGCGATCGTGCGCTTCATCTCGTCGTCTCCTTCGTCGTACAT
GTTCTGCAACCAAAGAGGAATGAGTAAATCTGGAGTACATGCATCTCAAACACATTACAAAAACAACGCACCTTCATCATATCCATGATTCCAGCAGACG
GGTCGCTGGTGTCGGGCTTGCTGGTCTTCACCGGGTTCTTGGCCGTGAGATTCATCCATGTGGTGTCCTTGTCAGCCTTGTACAGTGAGACTGTAACGCG
GTTCTTCTTGGCGCGGATCGAGCTCTTGGCAGGGTCAATCTCTTTCTCCAAGTGCTGCTTCAACAGACTACAAGCGACAACAAAAACCCACAAGAACCTC
GTCAGATGTATTCTTCTCACTCCAATTGACCACAACGCACCGGTAGTTCTTGCCATCTAGTCCAATAATCTACCGAACAAAACCACCACCATTAAGTCAG
CTACTCCTCATTACCCATGTTATCCCCATCGAGAAAATCACGAACCTTGAGGTCGAATGACGTCTTGGTGAAATGGCACGTGATGTTCTCCTTGGGCAGG
TCACCGACGCCGTCGATGCCCGACATAACATAGACCGCCACCTTATGCTTGCCGTAGCCGTCGTCCTCCCAGCCGAAGCGACTGATCTCCGTGAACGTGG
TTTGGTCGCCGGCCACTGGCTCCACCTTGCGAGCCGCCACCTTGACGGGCGCCGGCTGCACGGGCGTCTCCGCCTCATGGTGCGGCTTGGCGGCCTTCAG
CACCTTCTGCTTGCGCTGCAGCAGCTGCTCCAGGTCGTGGCGGTTGCCGGCCGTCTTGGTCTGCGCCAGGAGCGTCTGCAACTCCGCCACTTCAGCCGCC
AGTTCGCTCATGATATCCTCAATAAATCCAAATCAGCAAATTTACTGCCAGCAATCGGTAAATTCTAGAACGACACATATATTATACTCTGGACTATTTT
AAACTTGATGTCAGTATGTCTAGCTTCAATGAAACTATGAAGACATATGTTTAGGGTGTCATATTATATTAGTGTACCCACTACGCTTTTCGCGCGCGAC
AGCATGGACGGAAGCGCCCTCGACTCGGTCTCTGCTGAGGCCTCTGGGGGCGTCCCGCTCGTGTCTCCGCCGGCTATAGACGTGGTCGGTCCCTCTGCTG
CGCCTGGTAGCGCAGGACCGGTCACCACGGGCCTTGTACAGCCCTCTCAACGAGCGTTTCGTTCGACTCCCAACTCCACGCCCAAGGGATCCCCAGCGCG
GCTCACAGAGGCGTCAATGGCTCAGTACGGACAGCAGGAGGTGAAGCAGACGCCCGATCGGCCGGCGACGCCAGAAACCGCGTCTTCGGGTTCTTCGCAG
CGATCAGGAAGCGACGCGTCCGAGGGCGAAAAAGGCGGCGACAGGACGCAAAATAATTGCCCAGGAGACGCTAATATGCTACAAGATGGCAGGAGTGATG
GTAGCAGAGTGCAACAGATGCAGGTGGCAGGGTGGATGGCAGGGCAAGGAGTTTCAGGACAGACCAACGGCGTTTTTGCTGTTGCGGCGGCGCCTGCTGC
TCCTGTGCCTACAAAGAAGCCCAAGAGGTGGTTCGATGTCATCCCGATGGTACTGCAGAACTTCAAGGCGCACGACCAGGAGCAGGTTAAACGTACGCGA
TGGATAATGTTGGGATATTTGTTGGATTTTTGCTGACGTAGCTCTTGTAATCTGCCATTTGGGTGTGGGGCTTTCAGAACTGGCGCTGCCGCAGTGTGTG
GTGTGTAAACTGTGCGAGAAGGCTCAAAAGGCGGAGGTCAAATGTCGACAGGATGACTGCAAACTGGTTGACCAACCTTTGTGCTCGAGATGCTGGGAAA
CCTCCCATTCTTCAGACGAGAAGAAACAGCACCGGCAGCTTCCCACAGCAAGTGAGTCATTTTCTTCTTCTTGGTTTGTAATGCTGCTGTACGCTAATCC
ATTTTTCTGATAAAGTTTGCCAACAGTGCGAGGTGGATCGAATTACCTTTTGGTGTGCGGATTGCGACCTGAAGTTTTGTCAAGTGTGTTTCGATCGAAT
CCACAGTGTAACCAAGACGAAAATCCATCGCAAAGTAGCCTCAGAAGGTACGTTTATCGCTGCAAACTATTCACATGCGGTCGAGTTACGCCGGAAAGTG
CTTACTGTTTGCATGTTGTTAATGTCAACAGATGCACCTGGAAGCTGTTTGGTAACATCGGACTGGTCGGAGCCCTTTCAGAATGCAATTATGCAGATGA
TTGCGGCGCGGAAGCATCCACCTCCGGCTTCGGCTGGCAGTGGAGGGGATTCCATCGGTGGAAAACGAAAGCGGGATATTGAAGTAATCGTTATTGACGA
CGATGACGATGAAGATTTTGATGATGCAAGTGCGCCCCCTATCAGCAATGGAATTTCCGAGCAGCATGCTCAAAATACGCAATATGGCATCAACACTGGA
GCAGAGAATGTGGGAGTAGAGAATGCATTAACGCGTTCCAATGCAGTATTCTCGCAACTCCAAATGCCGAACCAGGCTGTTCCTAAAAGCACATTGTTCG
AGCCCCCAGTTATCCAGAACGCTATGATAGAGCCTATTCCGTTTCCTCAGGAGCTGGGAACCGCATCGTCATCGCTATCATCGTCTGCTGAATTTGGATC
GGCGCAGACTAGATCTGTTGGCACAATATCGTCAATATCAACCGGAAACAATACAGTGAACATCAACACAAACGCGGGGAGCTCGCAGTGGAACAACGAA
ACAAGTCAATTTGCAGCATCTGCCTCCATGGGATCAACAGGTTATACCGGCGGGATGATGAGTGTAACACCGAGCTCGACACCGGCTTCTGTAAGCATGG
CAAATGGAGTGTGGTCGACAAATTCTGCCATTAGCACAGATTTGGCCAGCACATCCAATTCTGGCAATCTTTTGCCACTCGGGGATGCAGTTTTTGCGGA
GAATGCGCTGGTTGATTCTTTGATAGACCGCTATCATGAGATGAACCAAAATGTAACCAATATGGAGCTGCAAAGCGAGCAGCTGACCAGACAGATAGCA
GTCGCAACGTGTCAAGGTCCGTACGCAGCAGGATCCATAATGGGCATGCTAAACAAGTTGCAGCCTGTACTGGAGGCAGCAAGAGAACGACGCGACAAGT
TTTTGATCGCGATGATTATCCAGTCGAACGACATCATGGCTGCTGTGCGACTTCTGCGCTTGACGGAACTCGGTGATGTACCTCAGGTTCCCATGATTAG
CCACCGGAAGTGCCTGCAGATATCCAACGAGATCAATCAGCACAAGAAGAAGCTCCTCGAACTGAATCAGCAGCTGAGTGAGACGCTTAACCTGTCTAAT
GTTGTAAGCTCCAACTGGGAGAACACGCTTATTCGAACTACCAGTGGCAATATTCAGATGCATGAGAAGAGCATCAAGAAGCTGAAGAAGGACCGCGAAG
TGGAAATTGTGCGTATTGTACAGTTCAGCAACAATATCCGCGTGACACTGAAGCTGGCGTTTCAGCGTTCTGTGGAGATACGACGCCAGCATCAGCAACA
GCAGCAGCAGCAACAGTTTCAGCCGTATGGATAGTTTTGCTATCCAGACGTCACGCGAGACTGAAAAGCGAGGAGCGACAACGATGTAGGCAAAAGACCA
ATTATTTAAGTGGCAAATGAATGCACCAGTGTCAACCGTGCCGATACACAAGGAATCCAATCTGCCCCAGAAAGAAGTACAGCATCCTGCGAGCAACACA
TGGTAATGCATGAATTCGAGCTAACTTTTGCATAAGATAGCAGGTGAACTCACTTTTTGACCTCATGCGAGACGAAGGAGCCGAAGGACTTACCTACAAT
GACATGCCACGCACCTCCCTGGGTCTCTTCGATTTCGTGCTTGATTTGCTGCGCAACCTCCGTGAAGTGGTTCTTCTCGCCCTTGTACAGTGCTTTGAGC
GCATTGGTGGCGCTAGTGAGGATGAGCTCCTCCAATTCCTTGGTTGTGTCTTGGTACACGATGCGCAGGCCACCGACAGACACATCGTCCTTCTTTTGAG
CCTTGGACATGACTTTGATCGCCGAGTTGCTGTATCTTTTTCTGTAGGAAGTCGACTTGTGCACGACCGTTGGTATCCAATCGAGACTTGCTAATTCGAG
CAAGTTGGCATTTAGTCGCCGCTAACGAAACGAAGATGTCAAGGGGCAAGGACATTTTCGAGCACCTGGTGCGGCAAACAGTGCATACTGTGCTGTTCAG
CGATACATCGGATCAGCACCATGAATCTGCAAACGATTCTGTTGTCATAGTTGGTCCAGCGACACTGAGCAAAATGCTGTCGAGACGGCAACCGCCATGG
AGATTCGCTCTGATACGCTTCTGCATCGACTAATTCACAACTACGACAACCATACTGAAAACTCATCTGAAGACGAGAGGGGCAACAACGCTGATGTTAT
CAGTTGCACAGCATGGATGAAGGACTGTTCGAACTGGTCCATCGAACGACTCAAGACTGAGAAAGCTTTAATCAAGCAGTACGTGCAGGAGCATCGACGA
AAGCGTGCTGAGGACTGTCACAAGTCTCCCGAGATGCCTGCTGATAACTTCACAATTCACGAGGCATATGCACTGCTCAAGCTTTTTCTCCTTGAGCGGG
ATCCCGACTATCGACAGTGCCTACTGCAATCCATCGAGTGCGACAACTCATTCTTGCCATCTCTCCATGTACAGCTCACACTGTACGCGGCGTACTTCGA
GCGCACCAACGGAAGACCGGTACGACCGTGATGGTATATGCAAGTGTAGTCTCTTATTCAACTTCCGTTTGGCATCCATATTGTAGATCTCCCTAAAAAC
TGACGTGGAGCCTATCCAAACGCTCTATGAGTTCTTCCTCGCCCACCACTGCGCGTCCGAGTAACAGCTAGCCAAGTAAGAAACAAAATGTACTGTCTCG
CATTCGTGGTGCTGTATCGCTGTATCTTGGAGCAACCTACAGGTAGGAGCTGTACGTCGGCATGATGTCGTCCTTCTTGGAGTCCAGACACGGCACCGAC
AGCCACGCGAAATAGAAGGCGGCGCCGCCCATCACGTGCATCAAACCCTTTGCGAACCCGAGCGCCGCGTGGTTGTCGTCGTCGCTGAAGAAGACGGCGC
CGACCCCCACAATTGTCGCAGCGACGAGACAGCCCACTGCATACGCCGCCTTCTGCTTGTTCAGAGGGGAAATGTTGCTGCTCTGCGTGGCCACGCGACG
GTAGATGACGCCGAGGATGTAGCAGACTACGAGGAGTCCCTCGTAGAGCGCCGAGTCCCATCCGTCCTTGGTCTTGAGCAGCCACGCGCCCGCGAACGCC
ACGTAGCGCAGCACAATGTTGTGATTCTCGTCCTTGTAGCCCATGAGGTGCACGCAGAGCAACAGGAAATAGGCCACAGACAGCACGTCCGAGAGGAAGT
GCCACTGATCCTCCTTGAGGAACAGCTGCGTGTCGAAAGCCTCGGCGGCGTTGAAACAGAAGGAAACCACGAGCTGCAGCACGCCCACGAACAGCTCGAA
GTGGCGGCGGTTGCGCTTCATCACGTCCAGCGCCGGCAGCATGGCCGCGTCCGTCAGCGCCAGGAACACGAAGCGCCCGAGCTCCAACAGCATTTTCCTG
TGATTGCGATCGCCCCACAAAAAGTATCTGACTACTCTTTTATCCACCAATCACGTCCATACCCTTTACAAACCGATATCATGTATTTTGAAAGGTAACA
TGAGTGAATGCGAATCGACAGTCGCGTGATTTTAGGAACGAGCCATCAGTGCAAATTGCAAAGCACTTCTCAATTTGCGCAACACTGGATAAGATTCTCT
CCATGACTGCAGCTTCTCCGACGCCTCTGCTGCTGGACGGCAAGGCCACGAGCGACGTGGTCCGTACGCAGCAGCTCAAGCCGCAGTGCGAGGCGTTCCA
GAAGAGCCACGGCCGCCCTGTGGGCCTCGCCGTGGTGGTTGTGGGCGCCCGCAAGGACTCGGCCACATACGTGCGCATGAAGCAGAAGGCGTGCAGCGCC
GCGGGCATCGCGTCCTGGAAGATGCGGATCTCACTAGAGCAGGACGGTAACGAGAAGCCCGCGGAGAAGGTGACGGCGGAGCTGCTGGCGACCATCCAGA
CGCTCAACGAGCGCGCGGACGTCGACGGCGTCATCGTGCAGTTGCCGCTGCCCTCGTTCTGCGACGAGGACGCCATCCTGGCCACCATTGACCCCACGAA
GGACGTGGATGGACTGCACCCGGACAGTCACGCGGCGCTCTTCCAGTTCGCCACCAAGAAGACCTCGTCTCAGCACGACGAGGCGCCGTTCAGTTTGCCC
TGCACGCCTGCGGGTTGCATGGAGCTGCTGGACCATTACAACATCCCGCTGGAAGGCAAGCACGTGGTCGTGCTCGGTCGTAGCCAGGTCGTGGGCCTGC
CTGTGTCGTTGCTGTGTCTGCACCGCAACGCCACGGTCACCATGTGCCACTCGCGTACGCAGGACCTGAAGGCGCGTGTGCTTGAGGCCGACATTGTCAT
TGCGGCTATTGGACGACCGCGCTTCGTGCAAGGCGACTGGATCAAACGCGGCGCCACGGTGATCGATGTGGGCATTAACCCCGTGGAAGACGCCTCGAAG
AAGAGTGGCTACCGTCTCGTGGGCGACGTGGACTTTGACGGTGCAGTTAAGGTCGTGCATGCCATCACTCCTGTGCCAGGCGGCGTTGGCCCCATGACTG
TGGCCATGCTCCTGAAAAACACTATCCAGTGCGCAAAACGACGCGTGCAAAAGCAGTAAAACACAGAGGATACGAGCGACGGAATCCATTCAACGCTTCC
TAAAGTTTGGAGACTCACCCTGGCCCAGCAAGCGAACAAATCGACTTTGCCCGGCTTCGGCTGCTAATCCTAGTTGGTAAGGCGACAATTGTAAGTAAAG
CGTTCCCTGACCCCGTTCACTGCCTGTACGGGCCCGCTAGAAATCGTCGTGATGACCGAAGAGCAAGTCCTCCTCGTCCTCTGACGAGAACTGCCCGCTT
TCTTCTACGAGCTGCACGTCTTGGTGCAGTTCCTCCCAATATCCTCCGTGTGATTGCTGAGCTAGAGGGGCTCCTGTTGCCGCTTCATTATCGCCGTCTG
CAATCTCCAGGTTAGTGTCCTCATCGTTGTCGGCAGCTTGCTTCTCGTGGAGATGGTTCACAGCTTCCTCCAATCGTTGCAGTGCCGTCTTCGCACTAGC
AGGACGAGCTAATGCGGGTTGTTGCTGATGCTGCTCCTTCGATTCACCTGTAGATGCAGCTCCGAATCTCCGTTGGCCCTGAAGCAGTAGTCGCATGCAA
TCAAGTTGACCATACGCCGCAGCGATCTGTGCCGGAGTCTCCCAATCACTGTTCACAAGTGTTGGGTCTGCACCAAGTGACAGCAAATTCTGTGCCACCG
CTGCGCGACCAGAAAATGCTGCCCAGTGCAGTGGGGTATCACGTCTTTCGTCGGCGGCGTTCAAGTTTGCTCCGTGCTGCACTAGTCGAGCAATGATCGA
GAGAGCAGCAGGCGATTCTACCGCGTAGTGCACTGGAGACCGATGCAAGTCATCAAAAGCGTTGGCGTTCGAACCTCCGCCAGGAGTCAACAGAAAAGCT
GTCATGGCAGTATCGTGCGTCAAAACTGCAAGGTGCAGTGCTGTTCGACCTTGTGAATTGCCTTGAGCTTGGAGCATGCAATTCCATTCGTAGTTCACTT
CCGTAGGAACCACAAGTTGCTTCGTGCACTCGACAAACCCTCTCTCGGCGAGGCAGTGCACTGGGTATCGTCCTGCGTTGTCCGGCGTGTGAAGTGACAA
CGCTGCTGGGACAAGTGCTGAGATCGTCTCTATCGGGATAACATTCTCCGCGATTGAGTCCTTCATCATCAGCTGCTGCAAGAAACCACAAATCTCGACC
TGGTCGTCCTCACAAGCTCGATGTAGCACATTTTGACCCTTACGGTTGGTCGCTTGAACGTCGGCACCATGGGCCAACAATTTCTGCATAAAATCCAGGT
GGCCAAGTGATGCATACAACATCAATGGCGTATCACCGTTGCAGTCAACGGCGTTCACGTTCAAGTTTGCGCCGCAAGCAAGTAAGAACTCCAGCATTTC
GGCTCGTGATCGATAGTTTTCCTTGGAGAACGACAGCATATGCAACACACTGCGTTGCATCTTTGGCTCAACTGCTGCAATATCGGCACCTCGCTGCTGG
AGGAAAGTAGCGTCTTCCACGGAAGCGTTTTCGACTGCAGTGAAAATCGTGACTTCTTTCTTCGATGGAGATGATGGGGTAGATTTGGCAATTGGGGATG
CGAGCGTCGCTGGAGCATTCTGGACACTAGTGTCAATCTCTAGAAGCTGCTGGCGTCGTATTTGAGCACGGCGTTGACCCATTTGCCGTAGTAGCGCAAC
AGAACGGGATAACTCCATTTCGTCAACATCGTGATAGCAAAGCTCAAGTCTCACGTTATCGTTGTCTTGCAAGCAAACTGGAGACTTCAGTATCGGCAAC
GCATCGGTCGTAAGTTCCTGAAGAATATGCTGGATTTCAGAGGCCAAATACTCATCGCTTGGCTCAAACAGTTGAAGCAATTTACGTGTCATCTGCGAGT
CAAAGCGAAGTCGGAGTGGTGGGAGTACCTGCTTGGAATCCATCCGCGCACCAGCAGGGGTATTTGATTTCGACCTCTCCCATGCTAGCCAGGCACTAGC
TCTTTTGAAGTAGAAATGAAAAAAATTGCCAGACATCTCACCGTCTAAATTGCCTGTTGTAGTCGCAAGCGAGCGTTGACAGTAGAAATACATCCTTTGG
CGCTTCTGGTACTCGCGAACAAATTTCTGAAGTACTCTCGCGGCATCATGATAAAACAAAATCTGGTTCACACTGCGTGTTAAAATGTGCGGCAGCTCTC
GGTGGCTCCAGTCTTCAACGGTACTATCCACATCAGCTCGAGTCGTATCCTCCTCTGTTGTCTCAATCGGCTCGAGCAAGTCGCACACTGGTTCGTTGTC
CTCTAACGAGTCTATTGGTTCTTTATCACGCGCTTTCTCGGTCGTTCCTTCGTGCTTGAGCACTTTTTCGTTAGGGATCACCACGTCCCCCGGAGCATCC
TGCAACTTTCGTCGAGAAACGATAGCCCTCTGAATTCGTTTTGCAGCAAAAGAGCGTTTAGCCACCAATACCTTGCGCTCGATATCTTTTACCTCCTGAA
TGAGACGAAGCTCGTCATCCTTTACAACTGCGCGCTTCTTTTGTCGTACACCTGTGATCCATCTCCGCCAGCACATTTGTACTTTACTAGCGAACACTGA
TACCATAAGTCGATATTGGCGAATTTCCTCAGCTCGTTGAACTTCCAAGTCAGCCAAATACTGCATCCTGCATAACTTCCCTTTCCAAATCGCCTCGATC
CTTGTCGCTGCACTATTTTCTCGTCGGTTTTGGTGGTATTTGTTTACTGCTCGTGCAATGCGTCGACCATAGGATCGATACTTGATGGCATCAAATTGTT
GCTGACGCTCTTGTTCAATGTGTTGAAGTTGCTCAGCGTCGGGTTTTGATCCTGGTACTCCTTCGGCTTTGAGTTCCGCCGTTAAACGTGTTCGGCGGGT
TTTAAGCTCAGCATCATTGCTCTTTTTCCTGTGTCTCTGCTCTAGACAAAGATGTCGCCTCCTTCGCCAATGCTTTTGTATCTTTAAGGCGCTCAAATTC
TGCTTGTGGCGAAGACGTTCGTGTGCCACTTTTTGTCGACGTTGGGAAATCCCCCAGCTTCGCTGAATTTTGAGAGAGCTTTCGTACTGTTCCTGGCGTA
TACGATCCCTTTCCAGCTCTTCTTGTTGTTCATGGTGCCACTTGAGCCACAATGTCTGGATCTTGAGCGCACTCATGTGCTGCTCGTGCTGAATAAGCTC
TCGCTCCATTTTGCGGCGGTGTTGTCGATTTCCCCAGTTTCGTTGGATTTTCAATGAACTCGCATTCTGCGTTTGTACCAGATATTCCTGCTGAAGTTGT
TCGTCTTTGTGATGCTCCAACTCAGTGTTCCTCTCCATGCTTCGTCGCTGCCACCATCGATAACACGCACGTTGTATCCTCGCCGAACTTAGCTGCAGGT
TTTCCTTACACTGCCACTTTCGCCAATTCCGTTGGATCAGTGTGATTGACAGCATTTGTACGCGCTTAACTTCCTTCTTCTCCTTTTGCCACTTGTCCCA
ATGTTTTTGAATTCGCTTCGCACTAAGGTCTCGTCTTATTGTCAGCTCGCGCCATTGACGCCAACATTTTTGGATCTTTCTCGCACTAGCCTGTCTTTGA
ATTCGAAGCCGTTTATTTTCCTCCTCAGCTCGTTGCCACTGCTGCCATCGCAGCCACCTCCTTTGTATCATTTGGGCACTAGCTTCGCGCAAAATTCGGA
TTCGTTCAGCTTTGGCTCGCTGCTGTTGCTGCCGCTTCCGCCACCACCTCTGTATACGAAGCACACTGGAAAACACAACGCGTTGAACTTCTCTTTCCTC
TTGCTTGCGTTCGACCCATCGTCTCCACACAGCCTGAACTTTGCGCACGTTTGCTCGAACTCGTATCGCTGCCAAATGGGCATCGAACGTTTGTTGGTGG
TGGTATCTTCGATCTCGCTCGCGCTTGACCCACCGTCGCCAGGCACTCTGAATCTTGCACACATTCGCTCGAGTACGAATAGTCTCCAGACGCGCGTTGA
AAACCCGTCGTTGTTCATTTCTTCGTTCACGATCGCGGATGACCCATCGTCTCCAGACAGCTTGTATTTTTCGGACGTTGGCACGAGTGCGTAGAGCTTC
AAGGTGCATATCGAACGCAAGCTGTTGGGCACACTTTTGTTCTCGCTCACGTATGACCCAACGCCTCCAAACACCTTGAATTTTACGGACGTTTGCTCGA
GCTCGGATGGCTTCCAGGCGTGCATCAAACAAAACTTGTTGCTGGTGCCTTCGTTCTCTCTCGCGTACAACCCACCTTCTCCACGCACCTTGAATTTTGC
GGACACTTGCTCGTGCTCGGATAGTTTCCAAATGCATTTTGAAAGCTTGTTGCTGTTGATTTCTTCGTTCGCGTTCGCGTATAACCCCCCGTTTCCATAC
TCCTTGGATTTTGCGAGCATTGGCCCGCATTCGAATCGCTCTCAGATGCGCGTTGAAAGCGAGTTGCCTACGTTCTCGTTCGCGAGTGATCCAGCGCCTC
CACACACTTTGAATTTTCCTTACGTTAGCTTGAACTCGAATGGACTCCAGGCGTGCATTAAACAACAGCTGCTGTTCACGTCTTCGTTCTCGCTCGCGTA
TAACCCAGCGCCTCCACACGCATTGAATTCTACGAGCATTGGCTCGAACTCGGATCATTTCCAGGTGCGCATTAAAAATTCGCTGTTGTTCACGGCGACG
CTGTTGTTCTTGTGTCCATTTTCTCCACCAAGCTTGTAGCCTTCTAGCGAGGGCTTGCCGTTGCTTGTTCTCCTCTAATTGAGCAAGCGCCAGCTCTTGA
GCACGCTTGATTCTTTGATGGTGCGTCCATCGACGACACGCTCGTTGAACTTTCCGAGTACAATTCATGCAACGCAAGTACTTCAACCTGGTCGACTTGT
GCTCCAATTCCTTTTGAAACCTAGCGACAGTATCAAGCGCCAGACTCACACCTTTGCTACTTTCACACTCTGCAAGAAGCTTGACTGCAATGATGACTTG
TACTAGTTGGGCTCGAGTTTGCTCAGCAATAAGCTTATCCTGAGCAGACTTTTCGTTTTGCTGCATTCGTATCATTCCCACGGTTCGGTTATTGCGATGT
TGACTGATGCGTTGATGCATGAAGCTCGAAGCCTTAATCAAGGCAACTTCGTGCGTCTTCGCTTCGATCTCTTCCCTTTGCCTTCGTTTCTCCTCCTCCA
TCTCATGTACCGCTGAGGCACAGATTGCAGCCTTTTCCTTCTTGAGTTTTGAAAGCTGCATCTGTCCTGAAACCCAGGAAGCGATCACCTGCATGCCAGC
CTCGACTCGACTGTGTTCCAAAAATGCTGCTGCTCGCTGGGCTTCCAGCTGCTTCTCCGCTGCTAATTGATCCTTAGCTTGTAAGAGGGCTTCAGAGCGT
GCTTCAAGCTCAGATAAGCGTCGTTGAAGCTCAAGCGCAAGCGTTGTCGCTGTTCGTCGCTGCTCAAGCTGATCTTCGCAGGACATCAACTCGATCTCCA
TCTTCTCTGCTTGAAGGTGTGCCTGTTTCATCAAAAGTTGATGTTTCTCGCTTTCTGCTTTCCTGGATAGCACCCGAGCATCGATAAAACCTTTGATCTT
CTGCCTAGCAGCATTCTCTTCTGAAACCCTTTCTCGTTTTTGATGGGCTTGAGCAATTTTGCGATGTCGGGCGTCACTTTGCAGTGCTTGTTGTGCCATC
CGATCAAGTTTGCGCTCGAGCACACGCACTTGGGTACGCGTCTTGTGAACGCGCTTCTGGGTTTCAATTCCTAGTTTCTCCTTCGCAAGCAGCTCCTTCT
GAAGCTTAAGCGCATACTGTTTCTTTTCCACCTCAACTCGCTGCAGCTTCTTGTGAAGAAGGCATACTCTGAAAAACATTTGAATCTTCATCGCTGCCAG
TCGGCTTCGTCGAACCTCAACTGCATGCTGCTGTAGTTGTACGACGCGCTCATGGTGCGTAAGCAGTTGCAACCTTTCTTCCTCTGAAGCCTTCCATCTG
CGATCTAGTTCCGCCAATCTAGCGTCCATGTCCGCAATCAATTCACGTCGATGCTTCGAATTGAGCTTCATGGTCTTCTCCACGTCTCTCTTAGCTTTTG
TCCACTTTAGTTGCTCCTTGAACATAATGTTCTTGGTCAACTCTTGAGCTGCTTTCAACTTGCGGCGCAGTAAAATCTCCATTAAAAACCTTTGGATGTC
TTTCAAGGCTCTCGCTCGTCGTTCTCTTTCTCGAACGAGTTTTTCTCGACGCTGCTTTTTCTTCTTGACTTTCGAACGCTGGTGTCTCCACCACCGAACC
ACTTTTTCCTTTGCATATTCTCGCTGTCGCTGTCGAAGCGAAATGCTCACGAAGAAGAGCATACGATAGAATCGCATATGGTCAACCGGAAAACAACTTT
GCGTCTGGCCACCTCCTGATTGTGGAGGTATATCCTCCAGTTTCGTTGGATTCGACACGCAGCGATCGATCGGACACGATGATCTTCATCTCTCCGAGCT
TGCAATCGTCGTTGATGATGGCAATAAATAAATTTCTTGATCTTCCGCCATGCAACTGCTCTGCGAACGACCTGCTTTGCTCGTTTTTGCTCTGCGCAAG
CCTCTTTCCAGTAGGTAAAGTTTCGACGCAGCATCTTCAGCTCTCGCTCCAAATACTTTGGAGCATTCCCAACCGGAATTGTAGGCGATGCATAGCCCAT
TAACGACGAGTACGGCTGCGCTACCGACAGAATGTGGTCTTCGACCTCGCGTTGGGACACCCAATGACTCATGTCAAATGCTGCAACTTGAATATCTCGA
CAAAGTGAGAAAATTCGGTTGAACTCGGAAGGTTCGCTTTCATCGTCACCCTGATAACTCGACGATGCTGAAATATTGCTGCGTGATGAAGGAAAAGGAG
AATGAGCTGCCTGTCCAATCACCACTACTCGTGGGTTACTACGTGATGAAGCGGGTGTCGAATTCATCACCTGGTCACTTATCATCGTTGGTGCATCACT
ACGGGATGAAGTTGGTGAAGAATACGCCGCCCGTTCGCCTGTCGCTGTTCGTGCATCATCAGTACGAGATGAAGCTGGCAACGAGGGTATCGCGTCGTCT
CTAATCATAGTTGATGCATTGCTACGCGATGAAGACAGCACCACATCTCCGCTCGCCATCGATGGAGCTCCATAGCAAGACGAAGGGGGTGAGGAATATG
CCACTTGATCTATGGTCGTTGTCAGCGTACTTGTACGAGATGCAGCAGGAAAAGAATGCATCACAGGGTCAGATGCCACACTGCTACGGAATGAAGATGA
CGAGAAATACGCAGCCATATCGTCGACTGATGAACTGAGATGCACTGCGTTTTCAAACGGGGACTGCGCTTCATCAATCGATCGGTAGCTGTTAATTCTG
GGAGAATCCAGACCCTCATGGCTCTCGGTCGGATGTTCTGATTCCCCTTCAGGAATTGCGAATGCGTCGTCGTTCCAGACACTTGGAAGTAAGCTCAGAG
CCATCGCGATGTTCGAAACAGCACTGCTTGATGAGTACGCATATTCATCGTCATCTGGTGTCGCTACCTCTGTTCGTTGCTCAACGCTCTCCGTCTCGCT
TGTAATGCTTTCCATCGAAACGATAGCTTCACTTTGCATAGATCTATTCGTTGGAGCAGGAGATACACCAGCACTGGATAGTATCGCTGCCATTGCTGGC
AGAACCTCGCTCTCGACATGATCTGCTTCAAGTTCTTCTGCCCTACTTGAATCCAAGCTTTCAGCCGCGTTGGGTGGTATTGCTTCCTCAGGCTTCAAGA
CTTCATCTGTTAATGCAGACTCTGAAAAAGAAAAACTCGGTAGCATTTGCAGCGCCATCGCTATACTCGACAACGCCTCGTTCGATGAATACTCAAAGTC
GCATTCATATCCATCGTCATTCAACTCGGCATCATTTTCCACGTCATATTCAACGAACGACTCCGTCTCAGTGATTAAAGCCGCTTCAACATTCATCCAG
TTGTCCATAGTATTACGTGAAGAAGTCAATTGTTCAATCTGGAAAGAGGAAAGTAGAGCATGAGAATCTAAAGCATTGAACAGCATTGGTTCTTCGAGGC
GTACAGAATGTCCACCCTCCTCCACCGATTCCGAAAAATCTACTTCCGTGATGATCGGGCCTGACATAATATCCAAGTTATCGACTTCTCGTTGAGGTTG
GTCCTTAGTCACAACAGGTACGGATGGTCTCCTCACACTAACCAGATTTCCAGGTCCCTCTTCGTAAACCTGCATCGTTTCATCTCGCGATGATCGCGCG
GACAACGTACTTGCTGATCGTTTCGTCATCGGTATCTCGTCTTTCCCGCTGGCAGCTGCTGGCTCGCTCATTTGCATTCCAACATCGACGAATGTGCAAC
GATGATCGCATTTGTCCTCAGAGTTGCTGCTTCTCTTTTTGGACGCAGGTCGCTCCGAGTGAGTACTTCTGCTAGAGGATTTTGCTAGCGCTGCTGTATC
CAGTGGGGGAAGTGGCAGCACTAATCGAGTAAGTTCCACGGTGTCATCCTCCCCTCCAATTCCAGTATCAACAGTTCTGGCCGACATTTTCCTTGCAAAT
CGGTGAATGTCCGATACTGGTGACGCAGCACTATCCAAAATGGTGTTTTCTTTCCCGGTAAATCCTGAATCGGGTGGACTAGAAATTGGTGTCCATGCCG
ATGTTGGCGGCGTTGCTGACCTGGCGTTCTCGTTCTTTGACGGTCTTCGAACTGAGGCACTTGAGGTTGTCGATGGCAATAATTGATCGGGCACAGTAGG
GGTTAAAGATCGTTCAGTAGGTGGTCGAGCGTCCAATTTCGCTACGGTCTTCGATGTTGGTGAGCCAGCCCACGCCTCCACTACAGTTTTTTCACTTTGA
GATGTGTCTCGCCCGCCTGTGTAAGCTAGTCGAGAACCCTGACGATCCAACCGTTGTATCCGTTCATCTTCAAATGTACCATATCCATACGACACATTCT
CTGGCACACGGTGTTGATGCAAGTGCCTCCTATGCTCTCCATGAGACTGCAGATATCTCGGTATCATTCGAACAGCATTGTACCGCGTCTCAAGGTCCAT
CAAATGTAGCAATGCTGCTGCCACACGTTCTGCTGGTAAAATTTGCCAACCTTGGAGGTATCGTTGGGTCTGAAGCGCAAACGTCTCCAGTTTATGAGTC
AATAGCCGCAACAGAGACGTCGATGACGACGAAGCAGAGCAAAATAAGGCGCCGGACGTTGAACTTTGATGACAGGAACAGAGCAGCACCTCCGATGAGT
CCAAGGATAATCCATCTACGAATGGATTTCGCGTCAAACTCACTTCAAAGTCCTCGAAAAAGCGCTGTAGCGGTGGTGAACACGCCAGGAAGTCCGAGTC
GGAAGATGCCATCTGCAGCAAATACCCGTAAAAATCTTGCTCCAGGATTTCGTGTTCACCACTAACGCCCACGACATCAGAGCCGCCAAGCTCACTGCTT
AAATACACCACTGCCTCCACCACCGCAAGTGCCAGACTGCGCATCCTATTCAGCAGCTTCACCACTCGCTGCGGCACATTTTTCTCCACGTGCGATGCTC
GATGCAGCGGCAGTACCCCCATGAGTTCTTGCTGTAAATGGGCCATCACTTGGTCGCGCAGGTGCATATTTTGTCGAATTGAGTCGATCACAATCTGGGC
TGGCGACTGCTGTAATGGTGGCGAACGAGTCGCGCGCTGTACAGAGTTTGCATTGCTGTTGTGAGGAGATTGCTGGTAGCGGTGAGGTGCCGCGTCACTA
CGAGTGCCTTGCACCTGTTGTTTGAGCTTGTAGGGACTGGAGAGCCTCCTGGCTTGAAGCTGCTGCATCTGTCGCTCCGTAAGAGGTTTGGCCGCAGATT
CTCGAGCAGCTCGTGTCTGCAGTCGTGGCTTTGGTTCTGCACTGAAATCTTGCTCATTTCCAGGCTGGAGACTTCGGCTGTTGTTTAAGTCCCCTGTGTA
GGTCGTTCTCCTGCTCGAAGGAGCCTCCGACTGCCATGTCGCAGTTTGCTGCATACCCGCTCGTAGGGTGCCTTGGTACATCGAGTCGTCAAGCTCCAGC
TCCACTAGAAGACGTTGCTGATCATGACGTCGACGGCCACCGAACTCCGTAGCTCTGCGCGGCGGGGGGCTTTTCCCACCCCACAGGAAGGTTCTATCAG
CCATAGCCTTTTATAATTAGGCGCCACTTGCCAAATGCCCACTCTTCCTGCGCGCCGCTGAGCGTTTCCAAGAAACGTTTCGTCGGCGAGCTTCTTCATC
GCAGACACCTGCACAAAAACCAACAGGGTAACGCAACAAACACAACACTAGACTGGATATGGGTGTCTTAAGTTTTACCGGTGGGACGGTGATCGGGATT
AGCTCCACTTGTTCCTAGATAAGCATATCGCCGTCCTCCTCTTCCTCGCCAGTTGTCATAGTCGTCAGTCCCTGGGCTCGGTACAGATCAGCAATCTACA
GGAAATAGTGGGGGGAAATGAATGGTAAACAAGAGTTAGTACCGGATCATGAGCAAACACATTCAGTGCCGGAAACCAGAAGTTCGAGCGGACCTGTGAA
GAGTTGGTCGCCTGCGTAGTCTCCTTGTCGTCACGGATGCGAATGAAGCGAGGGAAGCGTAGGGAGATGCCCTTATCCTTCGCCACTAGGCCGATGGCTG
CCGTGTATTTGGGCGAGATGGACAAATCTGCGCCTAGGATCTCCCACACGCAGCTAGCTTCGAACCAAACGTCAGGCTTGATTCCTTCGTTGACAGCATA
ATCGCTTGGCGCCTTGTCGACCACTTTCTCCTTGAGCTGCTCGTAGAACTGCTTGAGCACTTCATCCGACAAACCGGTGCCCAACTTTGTAATGGGTTGG
TACATCTCGGTGTCCGGGTCGTAACATGCAAGCAAATACGCGCCGTAGACACCAGTACGTTTACCACGTCCGTAGAACGCACCGATCGGAACCAGATCAG
CGGAATCGCCAATGCCGTCGAGGTAATCCTTCTTTAGCTTCAGCCACTTGTGCGAACGGTTGGCCGGTTCATATGTCGCCTCCCTCTCCAGGGTCTTCAC
CATCAATCCTTCACAGTTCTCACGCACAGCCTCCTCCAGGAAATTGCGGACCTTATCAACCGCCTCTTCCATCGCCTCCGCATTATCCTTCACGTCGACA
CCATCTTCCACATCTAAGGAAGTAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGGGGTGCCCA
GGAATGATTCGCCGTTCAGGAACAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGTGCAAATAA
AATCAGAATCCAACACAACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCTTGTTAGTG
ACGCGGTCCACCGCAACCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGGGAAACGCT
CCGTGGAGTTCTCAAAATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCGCAGGTGAA
CGGCTTGCCCTCAAACCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGCACTTCTCA
GAAACATTTGCGAAATCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCTTGGGCACT
CGGAGAAGGCTTTCTTGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCCATCAGGAT
AGATTTTTCGGCCAAGCCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGGCCTTCTTT
TCCTTCTCACACTTCACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTGATTGTACA
CATGCTGGACAGTGAGACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGATCGCGCATTCTGCGCAACCTTACC
GAGATCGCCCTCCTTGTTGTACATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCAGGATAGCGTCACCAATGCCGATC
TTCAGGTTCTCAAATGGGGGCGCCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACGACGAATGACGTCACGGAAGAATG
CAGTGAGCAGGTCTTGGATGACGAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATACGGAGTCTCACGGGGTCCGTCGCT
CTCCTCTTCCTGTTTTTCAGCTGCGTTGGCCTCCTCTTTTTTGCTCACCTTGCTCTTCGACTCGGACTCCGTCCCACTCTTTATTTTCTCTGTCTTCTTA
CCGTTAGCAGGAGTCGTCTTGGTATTCTTCGCAGCTTGCAAGGAGAAGAAGCCAGCTTTCGTCGAAGTAGGTGACAATGCCTCCTTCTTCGTGTCGGTCT
TTTCAGACGCTTTCTTCTGCTCAACCTCTTCAACTTCCTCTTCTTCAGCCTCCTTCTTCGGCGTCTTCGTCTCCTTCTTGGGACTCTTGGTCTTCACTGG
CGTCACGGGCTTCGTCTCTTTCTTATTGGGACTCTTTTCCTTCTCAGGTGACGTCATGTCAATCACTTCCTTCTTCTTCTCCAAGGCCATGGGCAGATCC
ATGTCGCTGTCTTCATCTTCCTCCTCTACGATCCGTTGCCGGAGACGACGACGACCAGCTGCAACAATAATAAAAACCGAACAGATAATCAGCCACGGCC
ATATACCAGCAGCAAAATAAAGAGATCCACGTACGTTTCGTCTTGGTGGCTTCTTCTTCATCTTTTTCGTGTTCTTCTATGTGTTCTTCTTCCTGCATTT
CGACGTCCTCGGGCTCTTCCTCCATTTGTTTCTCTTCCTCCCCGTCTTGTTCTTGTGCCTTCTTCGCTTCTTCTTGTGTCTTCTTCTCTTCTTCTTCTTC
TTCTTCTTCGTTTTGCTTCTTCCTTTTCTCTTGTGGCTTCTCTTTCTTCGCCTTTTTCACGGGTTTATTGGCGGGTTTCTGCGCCTCGTCGTCCGCCGGT
TTGCGCTTCTTGGGGGACGACGTGGGGGCCCCCGCGCCGAAGAACGACATGATGGAGCGCTGCGTCTTGGGCGCAGCTAGTGTCACGTGAGCACATTTGT
ATGTGAGTGAAATGGGTCTCCCCCAAACAGCCCAAAATATACAGCACCTTTCTTCCCCATTGTCACTCCACGTTCGCTTTTCAGCAATTGCAGCCAAAAC
TTTTTGGCGCGCTCCAAAGTGTACCCATCTCAAGCGGTGTCAATAGGCGGATAGTGGAAATACAACAATCCTATTTATTTGGCGGGAAAGCTTTAAAAAG
GGTATCCAATCGTCAGAAATGGGTCGCAAGTTGCTGGCACTCGTGCCGTCGGCGCTACCGGCGTCCGCCAACCTGGAGCGCTTCCACGCGGATGCGACGG
ACGCTCCGTTGCTCTCAGTGGTCGTGTGGAGCTCCCACGGCCCTGGGGACGCCACGCGGACGCGTCAACTCGCGCTGGACCGCGATCGGCACCGACTGCT
GGAGCTGCAGCGCGTGCAGCCGCCCGATGGCGCGCGGAGTTGGTTTTTGGGCAACTCGGTGGTGCAAAATGGTTCCCTCACGCTGTTTTCACCCATGGAC
GCGCTTTTTGTGCTGCTGGACGCTGCATGGGCCCAGCGCAAAAGGTTCTCGTCGGTGTTTGACCTTTTGGCGCAAAATGGGAACACATGGCTGCTGCAGC
TCTCGACACTAGACCAAAAAGTGCTGGAGACGATCTGCGACGTGCAGACGGTGGGAGGAGAAGACGGGGTGGACAACCTCTATGTGAAGGTGAATGCGGG
TAAAGTTACAGGGTGGTTAAGGTCCAAAGTGGAGAAGGTGGCTGCAGTGCTGGCCACGCAGGAGAAGACGGCGGCCAAAGGTGACGCGTTCGCGGAACAG
GTAAATGTACCAGGACAAGAGGGAAAGAAAGAGTGTGCGGAGGTGAAAGAGGAAGTCGTCGCTCGCCATTATCGCGAGGCCATTGGCGTGGTGGGGAACT
ACCTCCCGGAAGAGTGGATCGAGCTACTGTGCAAAGAGTTCAAGTACGTTGATGAACAGAGTTTTTGTGTTTTTTTGTTTGTTAGCTAAACGAGTTCTAT
TTGTTGTTCTTAAGGGTGGAGACGGAGGTGGCGGTGAAGACTCCTGCCAAGTCGGCAACTGGTGCCCAGGACAATTTCAGGCGCTTCGACCGACGTCAGA
CACCCGAGAGTGGGTCCAAGCGCTCGACGCCTGCTACGGCTGCTGCGACCAAAAAGAAAAGCAAATTGGCTAATGTGGATCGCACCGGAATGAAGTCGCT
GACCTCATTCTTCGGCAAGAAGTAGAGAAGTTGCAGTTTTCGTTGCATTTCGCAGATATATAGAGCTGTTTATCATCTACCGTCGCGATGTCGAGCCCTC
CACGCTCACCCGGTGCACTTGCACGAAATCGCCCCAGCCAGAGAGGATCCTGAACTTGATAAAGGAGGCATCCGTTGGCTTGACATTTTCGCTTACAATT
TGCATCTCTCCGTCGGTCTCCTTGAGCTCTGGTAATGGCAACCAACCATTAGCTGTAGAGCACCAAGACAACCACATGATTTACTCACTGGCATCGAAGA
GCTTCTCCCATTTGGTCGGGGTTGGTCCACTGCAGGCTTCTACGGACACCTCCTTGACATTCCGCGTCCACATCTTGGCACGAACTACAGAAGCCGTCGT
TGCAAGCTGAACCACGAGTTCCTGAGGAAAGCTTCCTGTCGTCACCCACTTGGACGATTGCTCTCTGCAACAACCAAGGCAGCAAGGTTACAAAAGTTTA
CAAACGCAGAAGCAGGACACACCATACCCGTCCAAGATGTTGACCGGTGGGAAGTTCGGATCATACGAAGTCACCGCCGTCACCTGGGCGCCCTCTTCAT
CCAAAGCGAGCTCCATCGCGACCGAGACGACTAACAGACTTTCGGGGAACTCGGCTCTTGTGATTGTGGTCTGCCTTCTGTCCTAAAAACCGCACAGCTT
AAACTTAGAACGACGCCACAAGAACAAACATAAGAATAGCTTGGGACGCACTCATACTTATCATCTCCATTTGCACAACGCGGAATGCACAGGCGACTTT
TACTTGAACACCCTCCTAGATACCGACGTCGCAGGCCACAGCGGGTGGCTTTTTCACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTCTGCAGTCGCGGG
CTCTAAATCATGTTGGAGGCTGCCCAAAACCCAATTCACTGGACAACCGCCGACCTACTTACGTTGTCAGCGGTGGCTCAATTGACTCCTTGTACAGCCT
CTCGAAACCCGCCGACAAAATGTCGGCTGCACGTGTGATACCCGATCCATCGTCATTAAAGAGCTTGCAGTTCGACCACATAAGGCGAATGTCGTTGGCA
AAGTGCGTAGAATCAAGCTCCTTGACACCAGCCGCCACTGTGTTGCTGTCCACAATGTACGCTCCCTTCTTCAGCTTATCCTCGATTGTCGACAAGTCCA
TTGGCTGCTTCACCACCCGAGTGTACATCGGAATGTTCTCCACGGGCGTGAGGAATGGCTTTGAAAATGGATGCGACTTCAGACACGTGACAATTTTCAG
GCACTTGTCCAGCAAGCCTTGCTCTGAAGCCACAGCTGTGGAATACAAATCGAAACGAGACGGCTTCCGACACTCGGCGCATTGCCAATCCCCCTCCGGT
AAGTCACTCTCCTTCATGTGCAGACACTTTAAGTGGAAGGAGCGCGGGCACTTGTCGCAGCACACCAGATCACCAGCACCCTGACAGACCTCACAGAAAT
CCAAGTTCGTGTCCAGCTCGCTATCTGAATCATCGCCCTCGTCTTCATCATCTTCGTCGTCTTCTTCGTCCGCTTGGTTGTACGTTTCATCCTCTGTTTC
TTCTTCGTCTCGTTTCACTCGCTTGGCATTCTTAGGAGGTCTACCTCTTCCCCGCTTTGGGGGCGGAGTAGATTTACGCTCTTGTAGATTCTTCCTCTCT
GCACGAGGACCAACTGAAACACTGCTCGGTGTATCGTTTTTTAGCTGGCGCGGGCGACCTGGTCCATACGCTGGTGATGACTCCGCTGAACGACTTTCCT
TCGGATGACGTTGACGAGCAGGGCCGTACGCCGGTGACGATTCCGCTGAACGGCTTCCCTTAGATCCCGCCTCGGCTGTGTTTGCCTTCACACTACCATC
TAGCTGGGATGCAAGTTTTGATCTTGCATCAGGCGGATATCGGTTTTTCTCCTCATCGTTGTGTTCACTAATAGAGCTTTCATCGCGGCGCGCTAACCTT
GAATCGTTGCGTATATCGTTTGAATTACGTGGCGCTGGACTGTCCTCCGCATCGCTTTCGCTTGCTTTCCGCTTCCGTGCGTGGACTTCTTCTGCTGACC
GTGCACCTGCACTGGAGCGATCACGAGAAGTACTTTCGTCTGCCGAGTCCATCGAGCTGGTCGATGATTGATCTTGATATGGGCTATCTGCTTGGCGGCG
TCTGTTGGCAATACCTCGTTCAGCAGTCAACCGAGAGGAAGCTTCCATTTCATCGCCAGAACCTTGATCACCAGAATCTTGCGCATATCCACTGCTCTCC
TTCCTAGCTACAATTCCATTCGTACCATAGCGTAATTCAACCTGGCGATGGGTGCTATCTTTGCTGGATTGACTGCTGGCACTCAGATCCATCGCCATCG
ACGAAGGCTCCGTATCTTGGTTCAGCGTGCTTAATAGATGGACCAGTGACTTCTCTGACTCGGCACAATTCAACACAGTAGCCGCAGTTGGTGACTCCGC
TGAACCTTGATGAACAAGCGGCGAGGCGATTCTAGCAGCAACTCGGGGATCAACAGCGTGCACACTGTCAGCGATCACAGACAGCATATCAGTAGGAGTA
TCCTTTGCCGCACGCTTGGGAAGAGGAGGGTAACGAGGCAAAGGCTTCTGCTGCGCTTGCATATTTGGTGGGTAGCTATCACGTTCGCCCGCCGGATACT
GCCCGTAGTCGGACTGCTGGGTCGGTATTTGCCTGTGTCCCTCCCACGACCTCCCGTCCTCAACACCGCGAGCAGAAACTTCACCGCGCACAACGGGTGC
ACGACCATCACCTTGTGGGGTGGGCGGGTATTGAGCGTAACGGTGGCTGTCGCTGCTTGCCACATTTGGGGCACCGCTGAACGAAATTCGGCCATCGGGT
CCTGTTGGGGTAGCTGGAGGCGCGCGATTGTCCTTCACAACGGCAGTGCCCCCCTGTCCATTGCGACGAAGCGTGTCCAGGAGATAGCGCTTATACTTCT
GGACTTCCGTGACTTTTACCTGCGTGCACGAGGTGCACGGACATCCACTCGTGCAAACCAAGCAGCGCAGCAGACGTCGGTTGGGGGCAGAGCCGTTCCT
GCCCACGAACAACGCCTCAAGCCTCACTCTGTAGACACTGCGCAAATGCTCGCGACACAGAGAATGCCCCTCATCCGCATGCGGGCAGAAATTCACGACA
GGCACATAGTGGCTCTCGCCCGCTCCACACAAATGGCACAGTCCCTTGGCCACAAAGTTGGCCTCCTGCTCCGGAATCAAGTCCTCCATGGCCACAGCGA
ACGCATCGTGCAGTACGGACTCGTCCAAATTCACCTGTTCTCGGAGCATCTCCTCTACTCGAGGGGGCAGCTTCCTCTCTCTCTTGTAGTCCTCCGCCAT
CTTCCCCTTGAATCCCGTCGACGCCTCCGGCAGTTGCTGAGACCCTGTAGGGCGTTGTTGCATGACCCTCTCCTGATACATATCCGCTCTCCCCTGAAAC
CCTGTCGTTCTAGCATGGTACCCTGCAGTCGTTCTACCTTGGTACCCCGCCGGCCCTTGGTAGCCCGCTGCATCCACTGTTCTCGCCTGCGCGTAACCCG
TAGCCATTCTCCCTTGTGCGCTGTAACCTGTCGAGCTCTCAGCCACTCTCCCTTGGGGTGGGTACACGGTAGAACGCTCTACCGTTCTCCCTTGGTAGGT
AGAGTACTGCTGATACTGTGGGGGGGGTGCCTCCCGGTCCGGGGCCCTCCCCTGCCAAGCCGCGGCCGCTGTGGCAGGGACCACTGGCCCCGACGTAACC
GGTACGTAACCCTCTGGCGCCTTGCCCTTGCTCATAATGGCCTCCATCCACACTTCGTTGGGCGGGGGCGTGAGTCGCTGACGTTTCTGTGGAAAATGAT
TCACAGGATTCACAGGTCAAGAAAGAAAAGTTAGACGGGGAGGAAGAGGCCCGTAACACGCCGCTCCGCACCTTGTCCCCGTGGTCGCGAGCCGCCCCAT
GGTACATGCTGACCGCTTCCTCGCGCGAGGCGTCGGCTGCTCGTCCAGGCTTCGCGAGATTTGTTGTCACCACACGGTTTTGCCGCGGGTTGTGGACGCG
AAAACGCATACATTCGCGAAGAAATATGGAATACGCTGTCAAGTATGCGTTTTCGGAGGTACCCATCTCAGAAGCTTTCCTGCTCTGGTTTACTGTGCAT
ACAAGCATCATCGCCAGCGCCGCACAAACATTGCAAACCTGGCAGCGTTTCTCC