Description :
From Genome Similarity Track
Location :
Scaffold_4:1261505- 1304439
Transcript NameFunction/comments
Phyin_T30-4PITG_03279Putative uncharacterized protein
Phyin_T30-4PITG_03280Putative uncharacterized protein
Phyin_T30-4PITG_03281Putative uncharacterized protein
Phyin_T30-4PITG_03282Putative uncharacterized protein
Phyin_T30-4PITG_03283Putative uncharacterized protein
Phyin_T30-4PITG_03284Putative uncharacterized protein
Phyin_T30-4PITG_03285Putative uncharacterized protein
Phyin_T30-4PITG_03286Putative uncharacterized protein
Phyin_T30-4PITG_03287Putative uncharacterized protein
Phyin_T30-4PITG_03288Myosin-like protein
Phyin_T30-4PITG_03289Myosin-like protein

Sequence
42934 bases(100 bases per row)
AAGATCCCCCGACCTTTGACACGCTTCTCGGCTGAAGCTTCACCGAAGCTCATCCTCAATCAAATGCTTCGCCAAGCTGACTGTAAGAAGCTGCTGTGGG
TAGTCTTCTGGCACCTACTCGTGTCGTTGGTGTGTTGGTGCTGCATCAATCCTGGCTCCACGATAGCTCAAGGCCAAGTCCTTTCGCGGTCAGGATGTGT
GTGTCTACCTACAATCTTGACGGGCGCAGACTCGCCTGTTTCGTGCTACCAGACGAACTCCACCTTCGGGTGTGCAATAGAGCCGTCCGATTCCTGTGCG
GGTGGCGTATTGAACCGCGCATGGGACCTCTGTAATGGTACGTTTACCTTGTGTTATATGGATTTCCAAGATTTTTGTTGACTGCAAACCTTTAGTCGTT
GATGTGTATCTCGTTACCGATCGAAGGTTTTCAACTGCGTCAACAGGATCGCTTTATGTAACTTTGTTTGATGAAGAGAAAGTTGTGCTGAAAAAGACAG
AACTGTCGAATGAAATTCTCCGGAAGAAGATTTCCAAGGTGACGCTTCCATTGGATAATCAAGCGGAAGTCAAGACTGTCAAGGTAAATGATACTACAGC
AACGATGATATGTTGTAGCTCACTAATTGTTGCTTGGCGACGCTAAAACAGATTGAAGCTACTGCTAGCATATCCCTTCGGATATTCGAAGTGCAGACCG
CAGTGAATGACTTGCCACCTACGATATTTTCACCTCCTACACCTGGATCGATTTCATTCGTGGGTAATGAAGCCGCAGTAAATTCTGGGATCGTGTCACT
GGATTTTGTTCCTGCGACTAAGGTTTTAAATGGTCAGTAGCTGTCCAAACAATGAGCGACGCTGACTAACTAACGTTATGTTTCTGGTGACAACTAGACG
CCGCTAAAGGCCAGTGCGTGTTTAATTCAGTAGGGCGTTGTGGGTACCATGCCGACCTTCAACGGAGCTCAGACGTGCTTTTTCTAGCGGAAGAGGGGGT
TGAATCGATTGTGGCAGCCAAATCGGCCCCCACGTCATCATCTCGACGTTTATCTGAGCCCGAGAGTCTTTCGCAACCTAAGCCGCTCTCATCTTTAACT
GTGAGTGGTGATCTGGGTAGCGAGTATCTTAGTGTTATCCTGCCACAAGATGCCGTGGTGACGGAGCCTGTGGAGGTCCTAGTCAAGGATTGGCTTGAGG
CTTTTAACCAAATCCAACGGGGAAGCGAATTTTCTGATCCAATGTCAGTCGGAGTAAGGTGGAGCAATCCGTGTGCGTTTGAATACGCGCGGATAAGTGG
TGCTTCGTCAAGAGAACAAGTCGAGGGTGGCATATTAGTGACACGCTGGAGAATACGCCGTCGTGATGCGTTGCTAGAGATATTTATCAAACCTGACTTT
ATTGGGGAAAGTGACTTCACGGTTACAGTGGACGTTATGGTGGACGGAAGTATAAAGACGTACTCAAAGACGTATTTTGTGACCATCCAGAGCGATCCAC
AGATACAAAATTCGGACCTGAAGAACGAAATCAAATTGCTATTATCGAGGGCAGACACTGCCGGTGAAGGAACAGCTGGAATTGGTACACAGAACTCTCG
ACGGCTGGGAAATCTAGATACGTATAATTCTGACGTTGTCGTTGTGGAATTACTACCGTTGGTTATCGACCTGCAAGAGGATGACCCCTTTCGTCTATTG
GCTTCAGACCTTCTACCCAACATAGCAGGAACCAGTGCAACGTTTTGTGAGACGAGTGTGACGATCTTTTCGAAATTTAATGCGATTTATTCACTGGAAA
CACTATCGACAGGTGTCCAAAAGGTAGCGGCCATTCGCAATCCAGTTATCCGACACCCATGTCACGAAACCTTGTCGATCAAGCTGCTGCCCAATGCTAA
GAGCGTCCGCGGTGAGATGCGCGTTGTTATGGCAAATGCTGACGACAACGTGTTAGCTGTAGGAATTATTCCGTTCAGCTGGAGTGTGATTCCTCGTATT
GATTTATCAATGCCAACCCAAATTCTTCTTGGAGCTCACAATATCCCAACCGGGGAGGTCCTGGAATTGATTTTGAACTACTCAGGAGATTATTTAAACG
CGAGTGTGGAAATAATGATCGCGAATTGTTCTTCTTTACATGTTCAACCAGTGGGTTCTGCCAATTCAACAAACGAAGAATGTTCTTTTCTCCTGAAAGA
CGCCAAGTCTAGCGCATCTTTTAGTGGAATAACAATCACTGAACGTCAGGATCAAAACTCTCCAGTCGCCGCAGAGGTGACTATATCTCGATTCGTGCAA
GGTGTTGACAGCACTTCATGGACAATTAGTGAATCGACCCTCGTGTCGTATAATCTCCACTTTTGTGAGCTGACGGAGAGGAATGGTGGACCTCTCGTCT
TACGTAAAGGGAAGAAAAAGGAGATTGTAATTTCTTCGCTTGCGTCTATGGTTCTCGGTGACAGGTTGGTCGACTCGCAGCATTTGAAAAGTATCTCATT
CGTTCTGGATAATGCCATGTTACCTAAAGTTGGTAGCTTCTTGGTTGACGATGCCCCTGCTTATCGTGTTGAATTTTATAATTCTACAGCTTCATTCATC
ACGTTAGATGCTGGAAGTGTCGCTAGAAATTCCTTCACTCCACATCAGTATGGAACCTTTCTTGTCGACGTAATTGTGGAGTGGGACAGCGTTGGCAACA
CTGATTCTGGATGTTATTGTGCGGAAAACTATGTGGTATCGGTGTTACCATCATTTTCCCAGCCTTTGTTTGCTGCTCCGTACTCGTTCAGTCGAAAAGT
TCTCCAAGGATCTACAGCTCAAATTACCATACCAACGATGGCTACGTCGAATTCTGAAATTGAATACATTTCTCTTGCTGTTGCTGTGAACACGACGGAT
GATGCTGTTATCATCAAGCGCGATGGTGTCCAGTGCTTTCCTTCAGCAGACGATCAGCGCTACTTTCTCCTCGTTCAGCGTGATGACGCTATGGATTCTG
CTAACCGCGTTGTCCTTTCGATCACCCCGAGCAGTATTTTCTCGGGAATTCTGCAGCTCGCTATTAGCGTCTCCTCGATCGGCTTTGTGGAAAATGCGAT
TCCCTTTTCAGAACTTAATGTCGAGTCCTCAACCATTCGTCAAGTAGAAATCGAATGGATACCGGAAAGTGAACCACTGGAAAAACCTGTGACAGCTGGT
GAGGCTGTGTACCGAAGTCTCTCAACACAACTTGAGGGTAATGTCACACTTTCATTCGCATATCAAATGTCATCAGGTACGCTGTAATTGATCTGCTAAA
ATAAATTAAATTTTAACTTTTATGTTTCGATTTTCTTGCGCACAGAATTCTCTAGTATCAGGACGGACGTAATTTTGAATACAACAGAGATCCGACAAGT
GTGGTCGAGTGAGTCTGTCGCTGCTTCCCCAGGCCAGTGGAAATATGTCGATGCCTTCATTGGTCTTTCGTACGCTTCAACAGCTGAAATTGTTTTTCGT
GGTGTGGTTCCCGTGGATAGCACGCTTTACTTGAAATCAATATCGCTTCGAGACTACAAACGAGAGAGTAAAGTGGGAGACATCGAGTTTGTCCGTGCTA
CAGGCGGTATGATCTACATCGAAGTCAACACAGCACCATCTATCTCTGATCCCGTACTACTTCGCGCACATGTGAAGCAGGCGGGCAGTGCCGGACCACC
AGCACTACGCTTCGCAGGTACGATCTTAGTTTTATTGTATCTGCACTCGGTTTCCTGACGGTTTATTGCTTCATCAAAGGTGACGGACTTCAGTATCGTG
GCTGTATGCCTACCACGACAATGTATCCGTGCAATGACAGTTCAGGAATATCATTGACAAGTCTAGGTCAGTGCAGAAAGTTGTGTACCGCTGTCGAAAC
TCAACTTCGATTTACGTCCGAATCGATTGTGCGCAGTGCGCAAATGGTTTCTCTTTCGATCGACGAAGCGTTCACGATCGAGTTCTGGGTGTATTTGGAA
CACTTGAGTCTAAGTTCCAGTGATCAGCAGCTCTTGCTACTTTATGGCTCTCAAGATGGAAGCCTGAGCATTACGTTAAACAGCTATTTGCTCATATCGC
GCTGTCAAAACGAGCTTCGTGTACCCCGTGGACTTCCACTTCAGACGTGGACACATCTAGCAGTGATATTTAGTGCAAGCCATGAGGTGACAGTCTTGAT
GAACGGAGTTGAAATGGCGACTGGTCGACTTAGCAAGGAAAACTGCAAAGCTCCTGCATATGCCTACCTTCAACTCGGACGAGGTATGAGCGTGGACACT
TCGAGTAGGCACAGTGATTTCTAACATCGCTATACTACACGTTTGTTTGCTTCAGATACGATGGATATTCGACCTGAAACCAGTGTCTTGCAAGGCGCAA
TGGACGAGGTATGACATTTAGACCTGTATTGTTTGCAGATACACTATTGGATTCTCACGTATCGGTGTTATTTTTTGAAAGATTCGCATCTGGAAAACAG
CGCGCGAGCCAGCAGATGTGTTTGCTTTGTACCAGAAGAATATCGCACACTCTGATCTGATTCTTGTCTTACCTTTCAATGCTGCCCACAAGACCCACTG
GTACTCGTCTGGCGTTGAAGGAAACCATGTCGACTTTATTGTACAGAACGTACGTGCATCAAATTCGCGACAAATTCACAATTTTGGAATGAGTGGAGAC
GGAAATTGCTTTTACACGCTTTCCGAATTTACTGCTGGTGAAGGGTCTGGCCCTCACATTTGCGATAAATACTGTGGCGATGGAAGTGGGAGAACATGTG
GATCCAACACGACTGATAGTGTGGCGAGTCTGTATGGCAAAGGCCCAATTGGTGTCGGTGGTCTCTCGGCAACTACAAAGTACGAAATATCTGTTGAGTT
TCTAACTGATGAGGGGGAGGCGTACGATATCACAAAGCCCCTAACTGCTAGTACGTCCAACGTAACCGTGCCGGGTAAAGTGGATTATGTCAATGCTGCG
GAGCTCTCTGATTGGCAACTTGAGATTTACTGGAGCCCGGTAGATGATGACGGAGGGTCCAAAATCGTTAAGTATGTTGTCTTTGTGAATGGTAATCAAG
TAGCTGCTACCACGGATGGAGATACACTATCGCTCGCACTAAGCATTGCGCAAATTCCGACGGGTTGTAACATAACTGTGCAAGCAGAGAATGCACTTGG
TGTGGGGCCTCAGAGCAATCCACTTGCCTTGGTAATCGCGTATCGAAATCGTGCCCCACAAGTCCCACAGTGCTCTAGACTGCTATCTCGTTCAGGTGGA
AGTGTGGAACTTGTCGTCGATGACATCACACGTTTGGCTATCAAGGACTTATCATCAGTGCTCATAATCGAGCAACGTGATGACTCTTTTACCTCTTTCA
CAACGTCATTTTATCGGTTTAATGGATCGGCAGCAACGATCTACAAACTCCGTCACAACACTGGCTACGTCTTCCGTCTTGAAGTCATCAGCAAAACTGG
TCTGAGGAGTGGCTTCAGTCCCCCTCTTTCAGTTAGAACGGGAGATAGAACGAGTCCAAGCAAGTCGCTATTGCCATCGGTAGCTGGCGTGACAGGTAAA
CCAATTGGTTTAAGTTTTCTTAGCTATATCACTAAATCTCCACTCTGGCGTGGTCACTGCAGGGGGAGCGGTTAAACTAGAGCTACAAGAACCGCTCGAT
ACTGGTAGCTTATTGGATCTTTTTAATCTACAGATTAAGATGCTGGACTAAATGTTGTTTTGGTTGGTGATCAGGTGGCCTTCCCATTGCTCAGTACAAC
GTTTTTCTTCTGCACGATGGCACATTTCACAAGCTGACCAGTATAACTGCATCAAAGACAAACGAGAAAACGACGTTTACAGCAACGCGTGACATGAACG
GAAATCCGCTGCTCCCCCTTACGACGTACACTTTTAAAGTGCTTGCATTACAAGCCAATGCTGTCTGCGATACATTGACGGGAGAAGAATTGGAGAGTGA
CGCTGTAAGCGCGACAACAGGTGCTGCTGCTATCCCAGCTCCACCTTCACGTCCCGTGCTGTTGCTCGCGTCAAAGTGCTCTGCAATGATCACTATAAAG
CCCCCGGACGACTTCGGAGGTGTCACTGTGACTGGCATGACTATCGGAATCTTCTTGTCTTCAGGGGATTTACATGATAGCCTAGCAGTCACATTGGCTG
CTGGTGAGATATCAATACGAAATCTACTGGCCTATACAAGCTATGTTGTCAAAGCTGCCCTGAACACGACCAAGGGTGATTCTGGATTCGGAGAAGCGCT
ATCATTTACGACAAAAGATCCAGGACCACCCGGTAAACTAACCATGCTTGAAATCACTGATCTTGGTTCGAGCTCGCTACTTGTGCGATGGAACGGACCA
CAAGACACCGGAGGGGGTGCAATTTCAGGTAAAAAAAACTATCTGAATTCTGGATAAACGTAGGGGGGGCCGTAACATTTGTCTTGTTTTGCTTCTAGGG
TATTTTCTTTATCAGCGTGCGATAGTGGCAACCGGAACGCAAAATCTCATTTACAACGGATCCAGTGATGCCAGCAAGACCTCATTTCTCGTGGGAGGCC
TCCTCGCTAGGACCAAGTATTTATTTTCTGTTGCTCCTGTTAATCAGTATGGATTGGCCGGTACGGAGGACGAAAATGTCGTGTATGCAACGACACATGA
CCACGAGGCGCCTTTTCCTCCGACCGACATCCACGAAAGCCGAGTGGATGCTGGGTACGTGGAACTGTCGTTTTCTGAGCCATTCTACACTGGCGGTTTC
CCGACTAGATCTCTTCAGTACAACGCGCGTCTCCAATCGTTGTTATCATGTTTTGATGACACGTCCGGATGCTCTACATGCTCCCATGCTTTGAATTCTG
ACGGTGATATCGTAGCACTTGATGCTACTTCGAACGTGTGTAGAGCAGCAGTTTGCTCGGATAGTGGACATTGCTGCTTAACTGGTGGAGTTAAATGTGG
TATTCGAATGCTTGAGGAGAAGAAATGCGTTTCTACTGATGGACCTGGAATTTGCCGTATCGAAGGGTTACACTTTACCACAACCTACTTGATAGCCTTG
GCTACTGTGAACGATAAAGGGAATAGCTCGTATTCGAGCGGCATTATGGTCACTACAAGTGGACCCAGACGCCCCAGTGCTCCGCATCTGGAGCTCATCT
CTGCTACGGGAGGCTCAATTAGTTTGAAATGGTCACTTCCAGAGGTAAGCGTATTTTTTTAATTGATAATGTGACGCTTTTATTGACATGTAATGATTGT
GTTTGAATACTGCCAGGATAAGGGCGGTGCCTCCATCGTGCGGATGTCTCTGAGTGTAGATGGAGATGAACTCTTTGGCACTGAGTCAGCTCTGAGCTAC
ACTCATTGTGGTGGGCTTCAGCAGAGTACCGATTACATGTACACTATTGAGATCGAGAACGCTGCGGGGTTAACAAACCGAACAACGCATTCGTTTATGA
CGGCAAAAGCGACTCTGCCTGGAACCGTGAAGCTTTCTGAACCATTCGTGGACATGCAGAGTATCGCAATACCCGTTACGCTGCCTTGTGATGATGGTGG
CATTAGTGGTGGACTTTACCTCGCCTATCGCGTCATCAAATCTAGTGACACGACTGTAATCGGAGGATCCGCTTCGTGTTGCACAATTATCGTTAATGGC
TTGTTAGCTGCAACTGACTATCGACTAGAAGCTCGAGCCGAGAATTCTGTTCTGCATGGCGACTGGACTGCTATGAGCTTCACAACTTTAAGTGGAATAC
CCTCCAGCCCAAACACAACTCTGCTGTTTGCGACTTCATCAACACTCGAGTTAGCACTGGTTCCGCCATCTCAAAGTGGCGGTGGAACGTTCTCAATTGA
AGCGGAAGTAACAAATGCAGCAACAAACTCTGTGGTTTTTCGAAACACGCTGCAATACTCACTGGTGGAACGAAGATATGAATGTCCCGATACGCTAACG
GTTAGTGGTCTCACTGCAGATCAAGATGCCTTTACTTATATTGTAGCTGTACGGGCTACTGGATTGTACGGATCGAGCTCTTGGGTACGTCAGACGTACG
AAGTTGACAATGGAAAAGCTGGCAAAATTGGTTTTGTGGAATCGCTGTATCGTGGAGCTGAAGGGAGAGATGTCGAAGTGAAAATTGCACGAGTGTACGG
GACTACGACACCGGATGAAAATCATTTTCTGATCACTGCTAATGGAATTGTGCCCTGGTGGACGTGTTCACCAACATCTAATGGAGCAACTTGCGTTGCT
GACGAACAAGGTGACAACAGAGGTATGTACACAGGATTAAGCATGCTAACGTTACTTGCATTTTTTCCACTAAATATCTATGATTTTGCTACCAGGATAT
ATTAGTTTTGAGGCTGGCGAGTATTTGAAAACGATTATTCTCACGTTTGATGACTTACAATATGAAGCTACAGCCGTGGCATTGAGCCTGACTCTCGTTT
CCAGTACGACAAGTAGTCTTAGTAACACACAATGCGAAGTTCAGATTTATGACAATGGAGACGCTGGTAACTTGAGTTTTGGAAGTTCGCAGATGGCTGT
ATACGAAAACGAGGCTGTGGTCCAGATAGCAGTTGGACGAAGTGGTGGAGTCAGTGGAAAAGTGTCAGTGACACTTACGTCAACAATCAGCTCAAGCATT
CGAGAAAATCGACTGCAAAAACTTGTTACTTTACGGGGACTGGAGTTGAAAATGCTATCGTGCCAGTTGATCTAGCATGGCAGCAGTGCATTTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGATA
GTAGAAATTTGACGGTGGAAATATTGGACGGAGGGCATTTGAGTCCCCCCGCACGTCCTCAAATCACTCAAGTGTCATCGACAGGAGGCTGTATTGGAAT
AGAGCTCAGACTCCCTTCGTACATGGGCGGATGGTTTATTGGCTCATCCCTGATGTGGGATATCCGTGTGGGTGCTGGGCCCAACTACACAGTCGAGAAA
AACGGTTATGTCGTGTCGGCGCTCAGTAGAATCGATGCGTGTGGCCTCAATCTCAATACAAGTTATCCAGTTAATGCAGCTCTACGTACGGATAGCGGGA
CTAGTGAATGGAAGATCATCGACGGGTTAACGAACTCACTTTCGGTTCCAACTCAAGTTCTCGACCTGCTCGCGAGCCCCGTTACAAGTGGATTTGCACA
GTTATCGTGGAAAGCTCCGCTGGATATAGGCGGAATGCCGATCACTATTTACGAAGTTACAGTTTTGAACAGAGCCGCAAACGAGCAACGAACCATTAGT
GTACCTGGATCAAATCTTACTGTGGCCTTTAGTTTCTTATCAGCGTCTACAGAGTACAAGTTTTCTATTCATGCCGTGAATGGCGGTGGTTTAAGTGGAC
CGGATTCAAGTATCAGTGTCTGGACTGAGGGCGTCTTGATACCGAAGCAGCCGCCTGCCCCCGAATTGATTTCGGCTACTGGTGGAGCTCTACACTTCCG
TGTACTTGCTCCTGTTGACTGTGGCGGTTCCATTTTGTTGCATTACGCTGTCAACGTCGCTCGTCATATAGGAAGAGATTTAGCGTATCGTCTGTATGAG
ACGGGAACTGTTCAAAGTACTTCGTACGATAGAAACATCGCGAATGTTTCCATCTACGGCTTATTATCAAATTCCGAGTACTTCGTTACAGTGTCCGTGG
AGAATAGTCAGGTATTGTAATAGCTTGGTGTACTGCTATTGAATACGCTATTTAACACACCTTTGTTTTCAGGGTTGGAGCTGGACAAGTGAGGAAAAAA
TCTACAAGACCTTTGGCCCCACACCAGTTAGTGGCATGACAGCGCCCACGGTAGCTCTTGAGGACCCAGGGGAGCTGACATTACAATGGAATACTCCACT
AGACTCGGGCGGACTCGGTATCGTGGGGTATAGGATACAGTCACGTCACAAGCTCGCAACCGGTTCCTGGTCGTCTCTTAAAATTGTGTATGATGCCCGG
ACATCATTAGCTCGAACGGCGTTGATCACGAACATACTGGCAAACACCGAGTATGCATTTAGCGTATCTGGTCACAACTTTAGAACGTTATGTCGCCCCG
ATGAGGACATGACACCAAGCGAAGAATTTCTTATCACAACCCAAAGCGGCTCTGTTCCCTCACAACCGAAAAACTTTCGGAGGGTACAAGTGACTGGTGG
ATCTATTACATTGGCTTGGGACCCTCCACGGTCATCAGGGGGCGAAGTGCTGCTGTGGTATATCATTAAAGGAGGCCTTGCAGACAGCCAGCTTGACGCG
ATGGCAAATGTTAGCGCTACGAAAACTTCGCTCACTCTCTATGGCTTCGATGCTTCCACAACGTACCAATTTGCGATTGCAGGAGAAAATTCTCGCGGTT
CTGGATTATACTCTCTATCTATTAATGTGACTACGGGTTTTGTTAGTGCTCCGGGATCTCCGCAATCATTACGTCAAGTTTCAGTTGGTTCGGGTGGAAT
GATCAAGCTAGCATGGGAGGAGCCAGATGACTCGGGAGGTGCAAAATTGCAGCAGTACAACGTATTACGCGATGACAATGCGGCTGGCGTGGTCGTAGCT
GTCAATGGAACAGCAACATTTCAAGATCAAAACAGTATCCTTGCTGACAAGAGTTACAGTTATTCGGTATTTGCTTCCAACGATGTTGCCACTAGCACAC
AGCCAGCAGTGATCATTGCTCACAGCGCCGTCGCGTCTGTTCCTGGAGCTCCATCCGCCACTGTCGAAACTGGTAGTGGCTTTATTAAGCTGAAGCTGAT
ACCATCCAAGGACACTGGTGGTATTCCTTTTCTTGTCCTCGATTTAACTGTGATGCGTGGACTAGTGCCGGTTAATTCCTACAATACCACGGAATCGGAG
TTCACCGTGACTGGACTTTATGCGGATGTAGAATATTCCGTTACTATCCAGACTGTCAACGCGAAGGGGAAAAGTGAGGCTACTACAATAACTACCACAA
CAATGGCTGCAACAATTCCGGATAAAATGCTACTTTCGAGACTGGTAAGCGTGACAGGAGGCCGCTTACAGTTTGAAGTTTTGCCTCCTCCAAATTTTGG
TGGAAGTGAAGTTCTGGATTACAATTTCTATGTAAATGGAACTCTGAGGGATGTGGTGAGGATTTCGAAAACTGAGTACGACCTCGTGGGCTTAACTGCA
CTTACATTCTACTCAGTCGCTGTAACAGCAACCAACGCGGTTGGAGCAGGTGGACAAAGTGACTCGCTGATTGTTTCGACCGACTCGGTTACTGCACCTG
GACAAGTTTGGGGCTTAAAGCTGATCTCGAAGACGTATGAGCGAATTGAAGTGGAGTGGACGATGCCAAACGATACCGGAGGAGACGCAACAGCAGTCCA
GTTTGAAGCTGAGATTAACTCAAGCATTAGCGATGGTAATGTGGTCTCAAGTACAATGAATACTGTGGTACTACCCGGACTTGAGCCCGCCACAATGTAC
ACGGTTCAAGCTCGTGCATTTAATTTGATTGGAATGGGCCCATGGTCTACAAGGATCTCTGTGACGACCGATCCGGTATCGCCTGGAGTCATCAATTTTG
AAGAAGGCGCAGTCGACATTCGTGAAGATGCTGGATCAGTGACGCTTACTCTAATTCGCTCCATGGGTGGCTTCATGCCTGCTACTTGTACATTCTCCAC
GATAGACGGAACGGCAATAGCTGGTGATCATTACGTCCAATCGAGTGGTCAAGTCCACTTTATTCGGGGCACAAATCTCCAGCAGATAACTATCCCAATC
AAAAACAACGACGTGATCGACGACCCAGATAAATATTTCTCAGTCTCAATCGAGGAGTATAATGGCGAATCTGGAGCTATTGGAGACATCTCGGCGGTGA
ATGTTACCATCACTGACGATGGAGACGCTGGTGTAGTAGCATTCGAGAAAGAGCACTATATTGTTTCCGAAGCCGTGTCGACACTTTCTGTAACAATCGT
AAGGTCAAGACAATTCAGTGGAAACGGAACCTTCGTGATTATACCAGTATTTTCTGGCGACGGTGCAGTCGAAGGTGTTGACTACAAAATTCCAAACACA
TCGGTGGCATTTTCCGACCAGGAGACACAAGTGTCATGTAACATTACAATTATTAATGATTTAACCTATCAAGAACGAAAGCTGCTCAAATTGAAGCTGG
ACGTGGTAAGTGGGCGCATCGCTATTGCTGACCCTGCTGGATTTGCTACCGTCGAGATTTTGGACGACGGAGATACGTCGCCTCCGGGTCTGCCCACTAG
TGTTCAAGTTTTTGTGGTTTCTGGTGGAATGGTTAACCTTTCGTGGATAGCTCCAGAGTATCTAGGAGCTAAAACCCCTGGAGATTTGTCGTATGTTTTT
CGTGTTGTGGAAGTGCAAAGTGGATCAACCCGCGAACAGTTGATAAACTCTTTAAGTTTCTTGATTCCTCAGCTGAAATCTAGGAGTGGGTATGAATTCT
CGGTAGCAGCAAAAACGGTTTTCTTCCTCGGCGAATATTCATCGCCGGTACCAATTTTAATGAAAGAACCAACGCCCCCGTCGAGCCCCATCGGTGCCCA
GGTACAATCACAAACGGGAGGGATGGTTACATTGTCGTGGTTGCCTCCATTTGACTGGGGGGGAGTTGACATCAGCAGCTATCGAGTGAATGTGAGTACC
AGTACTGACAACAAACCCGTCGGGTCGTACAACACAGTCACAAATACCTTGTCTGTCGGTAAGCTGGACCCAGTCACTAGCTACAGCGCCACAGTTGAAG
CCATTAACAAAAACGGATTTATCGGAGAAGCGAGTCCGGCTGTTACATTTACTACGACCGGTGTCTCTATGCCAGGAAAGCCAACATCTTTGGTAATTAC
AAAGGCAACTGGAGGTGCATTCCTTGTGGAGATGGCACCGCCACTGGATTATGGAGGCTCCCCTCTTTTGTATTTCACATTATTCATGACATCCTCGCAA
TACCCTAGTGTCTTCCGCCAAGTATATCAAGGCGTTACTCCATCATTTTACGCGACACGACTAGCGTTTTCGACTACATACAAGTTGCAGTACAAGGTGA
CCACCAAAGTGGTAAGTTTCATGATATTCTTGTAGATATTTTAGCAGCAATTAACTTTATTTTATTCTTGTTTGTCGCTAGGGGACCAGTGAATTAAGTG
ATGTGTTCGTTGCGACCACAACGTTCTTGACATTCCCGGATGAAGCGCCAAACCTCGTTGCAGTGTCGCGAACTGGAGGATCAGTCACACTTTCCTGGAC
GCAGCCTGTGGATTTTGGTGGAACAGACATAACAGCCTACGATGTGGCATTTTTCTTGGGGTATGAAGTCAAATCTCAATTTCGACAAAGAGTATCGGAC
ATCAGTGTGAATACGACATTAGTAACTGCAAAAGTGGTGGGGCTTCAGGCAAATTCCACGTACGGATTTTCCGTCTCGGGGGTTAATGAGGTGAGTGTCT
GCGAAGATCCATCAGCTATCCGCAGTCGTACGATCCTGCATAGTAGTACGGATGCAGCTGTCTCTTTGCCAGATACTCCACTCGGTTTAGCAGTGGCCGT
AGCTACCTCCGGGACTCAAACGATACAATGGACCGCTAGCGAAGACACGGGAGGAGGCTCCTTTGTTGCGTATATCCTGTATTCGGACACTAGTGCTGTC
CTGTATAACGGTACAAGCACTTCGTTTACACGCGGATCGCTGATAAGGAATACCGCTTACGGATATAGCGTCTGTGCGTGGAACTCTGCTGGAACAAGTG
CTCAGAGTGCGGGTGTATCGGCACGTACAAAAACAGAAATTGCTGCTTCAAGCCAGCCTCTGAAACTAAGTCAAACAAGTCGTACCGGTGGTTCTATTGG
ATTAACGTGGCAAATCCCTTTGGACAGTGGCGGAGACACAATTTCAGCGTACAAGTTGTTTCGTAACAGCACTTGGAGAGCTGATGTTACAGCCGATGGT
GTCACCATGACGTTTCTAGATGACCAGGGGCTAGCAGCTCTGCAAGATTACGTGTATACTATACGTGCGATGAATTCCATTGGACTCGGTGCTGTGAGTG
AAACCCTTGTTGCTAGTACAGCTGGCGCTACCATTCCAAGCCCACCCACCCGACTGGACGTTGTCACCAAGGGTGGAAAATTCACCGCTACTTGGATACC
CGCCGCAAATTCAGGTGGTATGCCGCTGACATCTTTTCACTTAGTGGTGCGAAATGATACGGATATTGTGCTGGATAGAACTATTCCTATCACGCAATTA
TCTTATGTTACGTATGGCGTAAGGGCAAACACTATGTATACTGTTCTTGTGACTTCTCGGAACGAGATTGGTAAAAGCTCTGTTTCAACTCAAATAGTAA
ACAACGCAGCTGCCGCCCAGCCTGCAACCCCACAGGTTCCAGAGCAGTATTTTGAGTTGACTGGATTGACACGCTGGATGATCGTGCTGAAGTTATATTT
CCCGATTGATAATGGTGGAGCGCCGCTTAAAGGATTAAACTTGTATCAAAATGGATCGAGAATACGTGCAGTGGATTCAACAAGTCAAACGGAACCGGGC
GATACAACAATGCGCTCCACGTTGGTTGAAATTGGCCCTTTACATGCAGGTTATACGTATTATTTCTCCACCTCCGCTGTTTCATCCGTGGAAACAATTG
GAGGAAGTGGTCGTAGCAATGAAATGAAAGTGATTATGGGTCCTGCAACTCTTCCTTCGGTGCCAAATAATCTTCGAGTAGCACTGCGAACTGCGTTCTC
CGTATTTTTTGAGTGGGATAGAGCGGACGATACGGGAGGAGATGATGTCGTCTACGAGATCTCTTTTAACAATTTAAACACGTCCGAAACGGGTCAAGTG
GAGACAAACACTACGACCGTCGAGATCCCGAAGCTGATTCCAGGAAATAACTATATGTTTCGAGCTCGTGCCAGAAACTCTGCGGGGAGGAGTGAGTGGA
CACCGGATTTATCAGCTGAAACAGACGTGACACAACGCGGCGTCATTACATACAGATTGGCGTCGTCAACTGTCTTTGAGATGTTACTAGCGTGACTGTC
CAATTACTACGTGTGAATGGTTCTTCGAGTACAATCACCTGTAAATATTCCAATACTTCTGGGTCCGCTGTCTACAGTCGAGACTACACGTTGCCCCCAG
AGTCGGAGCGCTCATTCGCGTTTGTTGGAGAGACGACAGTAAAGAATTTTGATGTTCAGATCATCAACAATGACATCTATGAACCGATCCCCCGGACGGT
TGCTCTAACTCTCACTGACACAACAGCGGATCGTAGTGACCCTTTCCCGCCTACACCAATAACAATCACAATTGTGGACGATGGAGATGCTGGAATGATC
AGCTTTGCATCAACTGAGGTGACAGTTCTGGAGAACGCCCGCATCTTAAGTCTTCCATTACAGCGTGAATACGGCAAGAGTACAGCAGTGAGCGTCCAAA
TCGTTGCATACTCTGGTCTGGTCAGCACATCGCAGCCTGACATCGGATTTCGCTTACCATCCACTACTGTGGACTTCGTTGATGGCCAAACTTCTTCATC
TGCCAGTATTGTCATCAAGGACAACGACGTGTACGAGTTCCCGTACTTGTACTTCTATCTTACACTCGAAATTGCAACAGGAGCGGCCAAAGTAGGACCA
AACAACGTGGTTAAAGTTGAAATATTGGATGATGGTGATCGCTCTGTGCCAGGAGTGATGAAAGTTCCGACACTTGATAAAGCGACAGGAGGAATGCTGA
GATTGAAGTGGGGACCTCCTCTGAATGTTGGCGGACAAAATATCTGGATTGCCGCATACAACATTTCTATTCGTGATGCTAAAACTGCAAAATGGATTAC
TACGCCTACGAATGCTTCGATACTGCCGTTTGGGGGGCTAAATGTTTTAAGTGAATACGCTTTCACCATTTCAGCAATCAACAGTATTGGACGGGGCGCT
GACAGCGCTAGCGTCACGTTTTCGACAACAAATCTGACCACACCAGGACCACCTGAACACATTTCTTTACTGAATCGCACGGGTGGCTTACTAACCGTCT
CGATTGCGGCTCCAAGTGATGCTGGGGGAACCTCTATAACCGGATACGTGGTATATCTGGCCGACCAAGATGGCGACTACCAGGTATGAAGTAAATTACG
GTATTGTGTATCAAAGTCTCAGTTGTGTTGACACTCTTTTGCTTGTTCTTAGGTGGCTTTCAATGGCACTGGACACCAATCGTCGATTATACCAGTTAGT
GTGAGCAAGCCAAACACTGTATACACTATACGAGCACAGGTTTGTTAGCCCTATTCAAATTTTAGATAAGTAGAAGCGCTCATCACATAGTTCATTCATG
ATATCAGGCAATTAACGTCGTCGGAGTTGGAGATATGTCCGAGCCATTCTCGTTTGAGAGTGGACCCTTCTCACGTCCTGGTCCACCCCGACTCCCTGCT
TTACAATCTTCTCGAAGAGGTGGTAAAATAACGTTGGATCTCTTGCCTCCGCTCGACACAGGTGTGTGTATTGTAGTTATTGGGGTAAAATTCTTCCACC
ATGAAAACTGAGGTGTGGTATGCTTGCAGGTGGTCACAAGAATATTTCATACATGATTTACTACCGCAAACAAGGTCTTGGCGATAGATTTCGTCAGGCC
TACTATGTAGCAGACGACCTGCAGGTCACGATTTACCGCTTGGCGGCGGATAGTACCTACGATATGGTGGCGATATCACACCTTGAAGACTCTCTAAACG
CCATCACTTGGGGAAGAATCTCAATCTCCGATTCTAGGATCACTCTTTCGGACAATGTGACGACTGAGATTATGAAGAGCGGGTACTTCGATTTTGGCGT
AAGTCGTTGTGTAGCTATTCGCTCGGTTGCCTTCTGTCTATTTAACTATCACATTACATTGCTTTGTAGGGGTATTTGTTCGAGGTTGACACAGCTCAAG
TCCAATCCAACAACACTTTCGCGTATTCGGCGTCATTTAGCACCGATGCCGGGGCAATCGCGACCACAAAGCTGCAAAATGGTGACGAATACGACGTATT
CGTGCGTGGAACATTTAGTGAGATGGCGAGCTACACTACAGCGGCACCTACCCGACCTGGAAGGCCACCAGAACCTGATCTCGACTATGCGACGGGTGGT
GCACTTCATGTGCGTATTTCCTGGCCCGATGATACCGGTACGCGGACGCCTTTAATTTTTGCAAAACAATGTACATGTAGCAACTAACGCACTGGCTGGA
TCAGGTGGGATACCAATTACAGGCTATGAGTTTTACATAAACAACACAATGGTATAGTATTTTGTAGAGGAGTATGTAAGGACTGCATCGAGACTAATAT
TTCTTTGGTTATAGGTGGAAGGAACGTTATACCACTACATATCGCAAGGTGAATTCGAGTTAAAAGTAACTGTGGAGATCGGTGGATTGGCCCCCGAAAG
CACCTACAATTTCTACTACATCCCACTGAATGATGCATCTGCGTGTCCTGGAGCCGATGAACAACCTCCTGTGCAAGTCGAATACACGACTGAGAAGGCA
TCCAAGCCAATGCCAATCCAGCTGATACGATCTACTGGGGCCACCGGTGGCGGGATTCACGTGGAGTTAAAACCGCCAAACGACAGAGGGAGTGCCCAGG
ATCTGACTTACCAGATCTACATGAGCCCAAGTAGAACAACGCCAATATGGACGCAAGTGTACGACGACAAAGCCATCAGCTATTGGCAAACGAAGCTGCA
GAAGATGACCGAGTATCTGTTTATGGCTTCTTGTAAAAACGAAGTTGGTTCTTCCAGTAATTCGACAATCTTCTCACTACGAACAACTCTTGTATCTGCA
CCGGGTCCACCGGGCGACTTGACAAGGATTAATGCAACGGGTGGTATGGTTCAATTCTCGTGGAAAAGTCCGGAAGATGATGGCGGAAGCCCCATTTCGT
ATTACTCTGTACACGCACAGGATACGAGTGGAAGCCCTGAATTGGTACTCGAGTCACTCTTACCGCAAATAAGCTTCGGTGGGCTACTTGCAAGTCGAGT
CTATGAATTCAAAGTGTATTCTGGGAACAGTCTAGGAACCGGGTCCGACGCCAGTGTGAAAAAGTTTTCAACTACCTTACCGTCTTCACCCTCGTTGCCT
GGCGATCCGATTGTTCTCCAATCGTCTGGAGGTTCTGCTACACTCGAAATTAAAGTCCCAAACGACACCGGAGGAGTAAAAGCTGACGACCTAGTGTGCA
CTGTGTATGGGAATGGATTTAAAGTCCCAGCAGATGCTGTGCGTCGGTTGCAAAGTAACCCCATTGCGGCTTCAAAGCGTCGGCGTCTGACGACTAGGGA
GCTGGCTGTGGATGATGGAGCGTTTATCTATCTTCAAGCAGGAGGGCTTCTTCCCTTGACAACATACGCGTTCACTATTCAAGTATCTAATGACGTTGGA
GTAAGCGCTATCACGGACGGTATTGGAACTGCAACTTCAGTGGCTACGGTGCCAGGTGCCCCAGAGCCACCGACAGTGACAGGAGCTACGGGTGGTGCTA
TTACTCTAGCTTGGATAGATCCTGTCGACACGGGAGGAGTTCCCTTAACTTTATATCGACTTAGTATGAAACGATTGGATGTGGAAGTTGGGAGCTGCGA
GGGAATGATCCGTTCATGCACTGTTGGAGATCTACTATCCATTACGGACTACACAGTGACTCTGGTCACTTACAACCCCGTCGGGATGTCGCCACCGAGC
AACGCCGTCACGTTCACTACTGAGACCACCTCACTCCCACTAGCTCCTCAAGATGTCCATGTGGCCGAGTTGTCGAATACTTCTGTAACAATTCACTGGG
ATCCTTGTATCGACTTTGGTGGTGGCTATGTGGATACATACCTATTGAATGTCGTACAGATTTCGAGCCCAAGCGCTACATATTCTGGTACAACTTCAGT
TGATGAGCACATCCTTACTATCGAAGAGTTGATTCCCCAGACAGAGTACGCTGCCACGGTGGTAAGTACTGCCCAGAGTTATTGTCTTATGTACCGTGTT
AATTGATGATATGGTGTGTTAATAGAGAGCGGTCACTGGTGCTGGCGAACCAGGAGAAGCGAGTAAGACGGTCTTCTTTCGGACGCCGCTCTACGCCCAT
CAACCTTCACCACCACAAGTTGGTTGCCGTAAGAACTGGAGTTTTAGTAGAAGTGATCGTTTGTATGCTTTGAGTAACGTGATCTGTATTGGTTACATGT
ACTTGTAGACTCCCGTAAAGTGGCTAATGTGTTTTGGGAGACTGAAGATGATGCGGTCAGCTACCTCCTATATCGCGATGGAAAGTTCTACGTTGACAAT
GGAGAAGATATCACGTACGAAGACGAAATTGTCGTGGGCACTACGTACATATATCAAGTCCAAGTTATCCGATTCGACGGCTCTATCAGCGTTTTAAGTG
AAGCCACAACATTTACCGCCCTGCCCCCAGTAACAAGTGGTTTCGACTGCGTGGGAAACAAGGGTCACATCCACTGGCACGATTACAAGAACTTGGATCA
CGAGACATGGACCATCACCCCACACAATCAAGCAGGTGTTTTGATCAGTGTAAGTCTTGGTTGATGCATTATAGCGGTTCAGAGTTCTAATACTTGTTTT
GGTGACCGACACGTAGTTCTCGATATTTTGGCTTGAATGTGACCACGACAGCTTAACTATTAGCGTGACAAAAGGCGGTGTGACGAAGCAGTTATGGAAG
GGAGGATGCCATCGAAAAGGAGACTTTGTTGTGTCAACTGGGCCTGGTTTGGATAGTGTGACGCTCGAATTTACGTCGGATGGTAGTGTGGCTTACGAAG
GGATGGCTCTACACTATGAGGCTGTCGATGCAGCGGATGCCGTAGAGTCTGTTTCAGCTCCCTGCCCTCTCTCGTCCAACGGGTTTTGCTCACTGAATGG
AGCTTGTCGCAAAGGTTCTTGCTCGTGCTTTAGTGGATTTATTGGAGAAAGCTGTATAAATGCAGTTATCTGTCCTGAAGATCTATCAACATGTACATCG
ACAACCTGTGACCCGGTTTGCCTCCAGTCCCAGAATGACGTAATTGTCGTGAGTGAAAGCGGAGATGATACACAGGGAACTGGTGAGAGGATGGATACTT
GTACAACTGGCACAGATCCGAAAGCTGTCAAGTCGCTGCGACGTGCTCTTGAGCTCGCCACGTCTGGACAAACTATCTTACTCTATCCCGGCGTTTACAG
TGGGGCTGATAATTGCGGTGTTACTGTCTCTACCGCTGGTCTTCTCATTCGAGGACTGAGAGGCCCAATTCCAACAATTATCGATTGCAAGAACCTACTC
CGAGGTTTGATAATCACTAGTAGCGCTGAGCCAAACCAACTGGAAGGGCTCACTCTGCAGAATACTTTAGCAAGTAACGATGGCGGTGCAATTCGAGCTT
CGGATGCGTCTGTTCGGATGAAGAATATGGTCATCACGAATGCGAATTCTCACCAGAATGGAGGAGCCATATATGGGTACCAGTCCCAGCTAGTTTTTAC
TAACGTGGAGATCACAAGCTGCTCTGCTGCTAAAGGAGGTGCTATTTTCTTGGATGGGTCACGTTTAACGCTTGATCATTCGGTCGTTAAGCTCTGTTCG
GCAAGTCAAGGCGGTGGTATATACGCGCAGAATACTGTTTCGATAAGCGGTGATAAAGATAGTAAGTTGTGGAAAAACAGTGCCTCATACAATGGGGGTG
GACTCTGCGTCGCTGGAATTTTTACAGGCACAGCACTGAACCTTCTCGAAAACACAGCGCTAGTGGGGGCTGGCCTAGTAGGCACAAGTGGAAGTTCGAC
ACTCTCGGACGTCAACATCGAAGGCAATCATGCAGCCAATGATGGTGGAGGGATTGCGCTACTTAATACGGCAAATCTGGTGCTGCACAACTCGCCGATA
CAGACAAATCATGCCGGTCGCTATGGCGGAGGACTTTACATGGTATCAAACGGTTCGTTCGAGAATAGCTTGGCTTCAACAATTTTGGGCTGTACTGCTG
GTACGTAGATATATTTATTGCGAGTCGGCTTGATAGCTAACTTTGTTTTTGCGATCAGCTACTGGAGGAGGATTTTATGCCGGTGACTGGGGTTAACTCC
GCCTGAAAAACCTTCATGCTGTTTCATCTTCAGCTACCGTATCCGGTGGTTGTGCCGCGTTTTCTCGCAGCTCTGCAACGTTAAGCAATCCTGCTTTCGA
GAAATGTGATGCGCCGATAGGCGGTGGAGTGTACGTTGACACGGGAAGTAAATTATCGCTACTGCATGCTTTGATTGCAGACTGTACGGCAACAACTGGT
GCCGGAATGTACATCAAATCCAGCTCAGTAGTCGGATCTAGTGATGTGGCATCTGTAGTTCGAGACGGTCTAGCCAACTCTGCGGCAGGTGGTGTGTACA
TTACTGGATCTCCGAGCTCAATCCAATTTTTCGATGTGCACGACTGCTCAGCTGCTCGTGGAGGTGGCGTGGCTGTACAAGAAGCTTCATTAGTGACGAT
AAATTCGGTGAAAATTATTAAATGCAAGGCAACTACAAGCGGTGGCGGGCTCTATGCTCAATCCTCTATAATCCAGGTAAAATCTGTGGCTGTCAATAGC
AACGGGGCCGTAGTTGGTGGAGGGGTCTTTGCTATCGATTCGAGCCTTTCGGGTACTATTACAGTGAGCGCGAATAATGGAGAACAAGGTGGCGGAGTTG
CTACATTGGGTATCTCGACACTGGACGGAGCTATCATCACTTCAAATACAGCCTCGAAGAGAGGGGGTGGGCTGTCTGTTAAGACTGGTGTTTTATCATT
AAAGTCCTCAATAGTTCGGTCTTGCTCCGCTCCTCAAGGTGTTGGTGGAGGAATTTCGATCATGAATGCCGATGTAAAGCACCACGCATTGAAAATCGAA
AGCTGTGAATCTCTCCGAGGTGGAGGAGTTTACTTAAACGCGTCAACATTCTACCAATATTCGACCGAAGAGAGTGCTGGCATGAGTCAGAATGCTGCAT
TCTTGGCCCAAAACCGAGCTGACGAATACGGAGGAAGTATTTTCGTGGATGGAGAAGGAGCGGTCGTCAGTGACTTCGTAGTTACCGACAGCAAATCAAC
GTTTGGGGGTGGGCTAGCAGCTCAGAATGCGGATTCTTGCGTTGTACTGAATGCGGATATTTCGTCGTCGACAGCATCAACTTCGGGTGGTGGGTTGTTC
TTTGGATCTGGCGCTAACTGCGTGTTTCGGGACTCCTGGGTAACTAAGAACCAAGCTGGCGAATCAGGTGGTGGGCTTATGCTCTTTGAGGCGACTGTGT
ATCACTCGAACGTGGAAATCTCCGAAAACGTCGCCCCAACTGCAGGTGGCGTATGTTTGAATAGCGTGCTTCAGCCTGCAAATTTTTTATCTTGGGGTGA
TGCTGCGAGCCAAAGATCACGTATTGACGCGAATATTATCGATCCGAAGGGTGGAAACGGGGAAAATGTCTTGATGAATTGTACCAGCAACTGTACTCTG
TCAGGGTCAGTAATTTCTGGCGCAAATTTACAGTTCGGACAAGGGGCTGGTGTCTTTGTTATGGGTCGTGGTAATGCCACAATTTCAAACTCTCTTGTTG
CTAATAACTCGGCCGTAAAAGGTGGAGGCATCGCTGTTAGTGACGCGGCCAAGACGGTAATTGAAAATGTTGGGTTTATCGGGAATATTGCAAGCGATCG
TGGCGGTGGGTTATGGGCGGAAAGCTCAACTTTGTTACCCGAAGTCGGCCTCCTGAGCTGCGTATTTTACAACAACTCGGCAAGAACCAGTGGTGGGGCT
ATTTCGCTCTATGGAGTGAATTTGCACAGTTCAGTTTTACTGGTGGTGAAGAATAACGCGGGAAATGCTGAGTCGGGTATCGGTGGCGGACTCTACTGTG
ATAAACGTGTCAACCCAGAGGCACCTTCCACTGTCACAGCAGACAGGTGCCTGTTCTTGTCAAACAATGCACCGGTCGGAGGCTCCATCGCTGGAGTCAA
ATCCTCCCAGATCAGCCTACTTGACACAAATATCACGCGCGACGCTGATAGATTCTTCACGGAAACGTGGCCAGATCTTTTCGAAAACCTTGTCGGCTTC
AAATACGCTGAAGACCGAGCCCCAAGAAAGATCGACGCTCAAAAGGGAGATCTCATCTATCTTTCGGACAGAGATTCGGTTTTAAAGCTGCTTTCATCGT
ACGCAACACGCGGATCGGCAGACGCTGGAGGAGGGGTGTACATCAACGCTAACGCGTTTTTCTACACTGAAGACTCCGAAATCAGCTCCAACTCAGCAAA
CGAACGTGGAGGAAGCTTGTGCTTATCGAACAGCGCCCAAGCCTCTTTCGTTTCCGTCAAAGTCGTATCCAGTGGTAAGTCTGCTCGAATAGCTTGTGTG
AAATTCTTTTATTAACAGAGTATTTTTTTAGATTGTAAAACGTCTGGGGGCGGGATTTATGTCGAATCCTCATCAAAACTATATGCGTTAGGCTCAGAAA
TATCGGACAACTTTGCAGATGACTCTGGAGGCGGAATCTTCATTGACACGGGCGACAAAAACGCTGTCACTCTGAATGGCACTTCCATACAACGCAACTT
CGCTCATGGAGAAGGATGCGGTACGAGGCCATTTGCTCACGACACAAACAACGTTGACTAATTACTGTGTATATCGGGCATCTCCAGGTGTTTTGGTTGG
ACGAGAGGCGGTTTTTGCTGGCTACAAGTCTCAGTTCGTGGGAAATGGTGGGGTGACAACCAGCGGGAAAAACGAAGGAGGCGGTGCAATTTCTTCGATT
GATGGCATCGTGAAGCTCACAAGCTGTACCTTCGTAAACAACACTGCATTAGTTGGTGGTGCAATTCACTTGGATCGTGGTGGTTCGGCAGCGATCATGA
GCTCGGTGTTCACTGGGAATACTGCAGATCAAAACGGAGGGGCGATTGCAACAACCGTCAAAGTAAAAGTCACGATTGCGCTGCAAACCTCATTTGAGAA
CAATGCGGCTCATTTCGGAGGAGCCATGGCAGTGTCCGGGACATCCACTATTGTACTGACGTCAGTGAACTTTCGTACTAACCGAGCCAGCGAGAATGGT
GGGGCTCTCTTTATGACGGACCAAGCAATTGTTACTTTAAAAGCTGGGGAATTTGATGGTAACAGCGCCGTATTTGGTGGTGCCCTTTATTCTCAAGATC
AGTCTTCGACCAACATCGTGGACACGAAACTTATCAAGAATGCGGCGTTTACTAGAGGAGGTGCGATGTATTATCAGTCGATTGATAACGCCACAATTAC
TGGAATCATTTGTAAAGAGAACACTGCACCCAGTGGAGGGTGCATCTTCTGGGTATCGGATGATGAAGATCTCTCGCCTATTTATCCATGTACATCCTGC
ACGATGGTATCCAACAAAGTGTACGATATTGCAACCAATACGCGCGATGTCCATGTGATGTGGTGGCCTGAAAACATGACCAGCGGCGTGCCTATACTGG
AGCCACCTGATGAGGAATCGATTGAAGTGATTAAAACACGTAACGAAAGCCTAGAGAAGACAGTGCATGTGTGGCCTCGACTCAAGGCTGTGGATCTTTA
CGGGCAAGTTGAAGTGCTCGATAATCAGACCGAGTGCATGGTGAGTGACGGTCTGTGCAGTGAGCAAACCGAGCGATTATTATTTGAGCCACGAGCTCTG
GTGCGCTCTTCTGTTGGCGTTATCTCCTACCGTGGGGCCAGCTTCACAGCAGCCAACAGAACCCCCGAAGAAGGAGTTTACACTACAGATATCTCGTGCA
CATTACCAAGTTCCGAACCGCGGTATTTCGAGCAAAGTGTAAAGCTGCTGCAGTGTCAGCCAGGGTATTCAGTCAACCAGGGGTGAGCTCTAGTTCTCTG
TTCGACTGGTAATGCGCTTGTGACACTGATATTTATGTGTTTCCAGGGTTTGTGAACGCTGTTCGAAGAATATGTACAGGTATTACCTCGCGTCTTCAAA
GTGGTTCAGCTAAAACCTTTCGACTAAATATTTTTGTTTTCATTGCTGCAGTTTGGATGGAAAAAAGTGTTTCGACTGCCCTTCTGGTGCCAAGTGTAAT
ATGAATGTGCGCCGAGCGATCGATACAATTGCAGAGGAACTCGGAACGATATCCCCACGTACGGAGGAAGGGTACTACCTCTTTTCAGCCCCCGCAACAA
AGCGAGAGTCTAGTTGCAATAAACCATCCCTGTGGAAGGACGAAGATCCGTGCAAAAAGATTGCGTTAGGCAACCCAAGCAAGAACCTCTCAGATGTGAT
CTACGAGTGCTCAAATCTGAATGACTTCAACGTGTATTGGTCAGCAGATCGCCTATTCTCCTGTTTGTCGGGAAAAACCTTCTACACCTGTGCTGTAAGC
TTTCGAGGCTTATATATTGAGGGGTACGCATTGGTTTCTGACAGTTGCTATCTTGCCTACAGGTTGAAGGCGCATGTCAAGCTGATGTTTCGGTTCAAAT
GCTCGCACACACAGCAGCAGTGAGCACTGTATCGTGTACCACTGGATACGACCTGGCAATTTGTTCCGTGTGTGCTGATGGATACAAGCGTGCCAGGGAT
AATTAAGTGTTTGCGTAAGTCTCTCATTGCACTGAAGTCTAGCAAAGTGTTACTCCTGGTCTAAGATCTTTTGCTTTATGCTGCACAGCATGCAATGAGG
CAAATGCTGAAGTCCGAGCTTCGATCAAGTGGCAGAATTTTGTCATTCCTGTGCTGCTGGTCCTTGCGCTTATCGGAGGAGTATTTGGTGTGCGATTCTA
TCTGCGTGACCTCACAGAAATCGGCCTTCTTGCAAAAGCTGAAGCTGATAGGCGGCTAAAAGCTCCCGATTCAAAGAAAGGTCACATCGCTATACGTGCG
GGGGCGAAATATCGGAGACAATCTATGGCAGTGGTAGGCCGAGTGGATCAAGTGAAGAACAAACTTACTACCTTCTTCAAGAAATACCAGAAACGAAACG
CGAAAATGGTTTTCGGAGTGGATGTGAGTCCTCCACCACGGACGTTCCCAGTCAACCCCAGCAAGTTCAAGATTTTTATTGGGTTCTTTCAGATATTCGG
CAACTTCCAGAGCTCTTTCGTCGTGAAATGGTCATCCAATGTTCAAGACGTTATGAATGTTTCTCAGAAGTTCAATCTGGTACGGAACGGTTGGTCAATT
GGCTGTGTTTGACTTGACTATAACATGCGTGAACTTTATGACTAGGATCTGGTGGCAATTGCTGGAATTGATTGTGTGGTAACGAAAAACTTCTACTTCG
ACTTCACGTGAGTTTTGTTAATTATACAGTGATAACTAGCTCGCCGTTAACTGACAAGTGTTTGTGTTACGTGTTTTTTTTTACTTACGCCAGAGTGACG
GTGAGCCTGGTTGTACTTGCCCTTACTGTCATCACGGCGTATTTTTATGCTGGAACGCGCAATTATCGCTCAAAACTGCAGCTAATTCCTCGTAACTGCC
TTCGCTGCGGGCTTCCAGTTCTGGAAAGTGAGTTGATTCAAAACGACGACGAGAGTTTCAACCCTCTTCGCCTACTTCGCAGCTGGTGGCGGACGTATAA
TTTCTATAACCGTTCGAGCTCTTCAATTCCAGTGGAAGCAGCAAAAGGTGGTCTAGAAAATGAAAACACGGCTGCCCTCTCAACTATCAGAGAGACACGA
GCGCTGAAGCGAAAATTCGGAATGTCCCAAGTCCGAACGCCGTATTTGGGTTTGTTTCGATCAGTGCATACCAAGTGCCCGACTAAACGACACGTGCTCT
CGGGTGCGTTGCTTGATCGCACAATTCGTGGTAATCTTCGTGTCTGGCAAGCTCGAGTGAAGCTACGCATGAATTATCTCACGTATCGAAACAAATGTCT
GAAGCTGTACTGCTGGATGGCCCTCTTCCTCTACCCGTCTGTTTCGAAGACTATACTGACAGTCTACAACTGCCAGGAGGTTGGCGACGTATTTTACCTC
GTGGTAGATCGACGTTTGATCTGCTACAATGGTCAATGGGCGGTGTTTGGTATGATCGCGACGATCGGAGTCATCGTGTGGGTCGTGGGAATTCCATTCT
TTTTCGGGCTTTTGATCTGGCTAGCCCAGGACCGTGGCGTTGCTGCACGTATCAAGTTACTACGGAAGCCTCAGATGCGCGTACAACGGCAGAAGTGGCT
AAAGGAAGTGGACGAACAACATATTGAAGATGGAAGGTTTGTTCGGGATATGGACAACGTTGAGGTGCAGGACGAGGAGCTGGCGAAGTACATGAAGCGC
AAGAACTTAACAGTACGCCATCATAACCCCGAATATCTTATATTTTAAGCTCACAATTTCTGTTGTTGAAGGACTCGACAGTGCAAGCTAGACTGGGTTT
CATCTACGCCGAATGTGAGTACAGTAGCTACCAAATTAAAACTTGAAGCGAGCACACACTAATGCTTGTGCTGTTATTTTTTAATGCAGATACACACGAC
TACTGGTGGTTTGAAGTCGTGGATCTTTCCCGAAAGCTTTTCCTCAGTGGTGTAATTGTGTTCGTGGAAAACGGAAGTGTGGAACAAGTTTTACTGGCGC
TAGCTGTCTGGTACGTTTGGTTTGAAGGGATTGTGGGCTGGTTTAAAGTACTTACGCGTTCCTGTATGCTACAGTTTGACGACAATGTGGTTCTTGCTTT
ACTTCCAGCCGTACGACGGCTACTCTGATAATCTCATCGCGAGTATCACGCAGTTGCAACTCTTCTTCACGTTGTGGCTCGGAGTTATGATTCGGCTGAA
CGATCTGAACATCGAGTCCTTGATCAACGTACAGTTGCTAAGCTTCCTGCTGGTAGGAACGTGCATTGCTGTCACAATGTTTGGGATCAGTATGATTATT
GGGGAAGGGCTAGCAGAGTCACGACGAATATTCACCGAGACGACTGCACAGCGTAAGAAACATGTTCAAGAAGAAGTGCGGAAGCGGTGGTTCCAAGCCT
TCAATTACGCTGCCTATGAAGCTCAAATGCTGCGTTACGGTGGTCAACTGAGCTTAAATAACTTAAGCGTACCCGCTATACTGGAAGCCTTTCGGCGGGC
TAAGCTCATGGAAGGAGAATCTGAAGATGCCAGCATCACGTTTAAAATCGACGAGGAAGCTGCGGATCAGTCAATTAGTGAACGCCATCCTGAGTTTACT
TCATCAAAGGTCAACCCAGATGACGATCCAGATCTCAAGTGCGACTAAATCAGCAGAGTTCACTGCTTTTGTTTTTCTGGGTTGAAGGCTCGTGAATATA
CGTGCATACTTATACTGTAGGCATGCTCTGTTTCGATTCTTCGACGACTCAGCATTGTGTTACTTCAGCTTTTTTGAAGCAGCAACGAACCAGCCTCTAC
ATGTAGTGCGCAAACTTGTCACGACTTCATTCAGCGCCGTGAGTTTGGCTGATTAGACGATGGTATGCCGTAATTGCACACCTGGCACTCCTGTGTCCTC
CAGTGATACGCCCCGTTGACCACGTCAAAGCCTACCGCAAACTCAGCACAATATCGATCGTAGAGCGCTTCCCACTCGCCGAACGTCACGATCTCGTACT
GACGAGCTGGCGTGGAACCAAGACTACACGTCCAACAAAGAAAGATCAGTAAGTTCGAAAAGTATTAACTATACCCAGCCAGCAGGTACAACTTACGCTT
GCGTAGCCTTGAGTGACTGCTCCAGAGAAAACCCCGACAAGAACATGGAGATGTAGGGCGGCACAATGGTCTTCTGGTGCGACAAGCATACAAGCTCAGC
ATTCAGCACTGGCCCTGGGGCGTCATCTCCCTGACTGCGAACAAATTTCCGCCATTTGTTCAGCCACTTCTTGGGTACCAGGAAGTACGTCGCGTACTTG
CTTCTTCCACCCACGGACCAATGCGGTGCCAATTGCTGTCTCCTTCCTCCTGTCTCCACTGGTGAGAATAGTCCTTTCGGGAACCCGTTCTTCCTCTGTA
GTAGCTCCAGCATGTCCTCAGACCCAGCAATTTCCGTGTCAAACCTCGCTCTCTTCTTCTCCTCGGCCTCCAGCTCCCTCGCCTCTTGCTCTAGTACACA
AGTGTTGCAGTCACAACACGACCTCAAGCTGAAACCTTTAAGCTCCGGCGCGTAGACCGAAATCTCCCTGAACACGTCACCGCTGATAATAGCGCGTCGA
CTGCGACCCACGCACTGAGCAGCGGGAAGCAGCGCGTTGTGGGCGCACACGATCATGGCCCCAGCCTCGGTGAGAGATGAATTAGTCGCAAGCTTTAGCT
TTTCGGAGACGATATTTTCCCTCTTTTTAGCGGCATTTTGCCGTCTCTGTTGTCTTTTAGTTCGGCGGAATTGCTGTAAGAATTGCTCGAAGGCTTGGCA
GCGCTTTTTGAAGGCGCCAAGCCACGCGCGGCTCACGACAACGCAGCTGGGAGAGCATGAGGCCACGTCTTCGAAGGACCAGGAAGACGAGTGCGCCAGA
AGCTCCTTGATGTGCAGCACTTCGACTCCACGTAGTACAGCGAGAGACCGAGGCCAATGGGATGATGAGGCATCTAGAAAGCTCGAGACGGACCCAAAGC
GACGAGTGATGACACGCTCTAGGGCCAACTGGACGCATGGAGTTGACGGAGATAGGGACCGACACGTAGAGGTTACCTGGAGCACGTCTCGGGCGGACAG
CAACGAGAAGAGGTGCGCCAACAGGCCCTCCGGCAGGTCATCCATTTTGTGTCCTGTAGTGATAGTGTGAATCCCGACCAAATTTGCCGTTTTGGTCCGA
TTCAGTGAGTAGCAGCTATTTTTACTACAATAGAAAGAGTTAAAAATAGTGCATTCAATTTCTTTTGCAAATTTTTAATGTTTGAGAAATGGTTTTGGCA
TAATTTTATAATCAATATTTTTAATGATCTACTGGGACCTGGTCACCACCTCCGTTGCATTCGGCTAGCAAGCGTTCAGGAGCCTTTGCATCACCCAGCA
TCGCTCTAAGCGTACGTACAAGATGTAGCATGTGCTCTGGCACACGGGGGTGTGCAGTCATGCTGTAAGGTGCTTCAGTCTGTGGAAGGGACGATAGCCC
TTCATTATTTAAACAAAAAAGCAAACATAATATTTTAAGTTTTTTGGTTTTACGAGTAGAAAAGCTTTCTTGAAAAGCACTCTTTTAAAACGCTTTTTTC
TTCTTTAAAATTAATTTTTAATATAATGAAAATTTACCCAGCACTTTCGCCTAGAGATGGCGGTAAGCTCGACGACGCAGTTGGCCTGTGTGGCTGACCG
CTCGCCGGTTATGGTGACTCTAAGCTTTGACACTGTCATTGACAGGACCATTGCAGACAAAACATATCTGTGCCCGTGTATCGTCGTAAAAATCCGCCCA
ACACTGCTGCATGTTCTGGTTGCCAATAGCTTGTGGGTGCGTGGATCGCAATAATGGTGCTTAAGACCCGTACTGATGCTAACACGACCAAAATCTTTCA
GTGTGTGGTCAGGTCCGAAGTTCCAATCACAGACGTCGCGGACTACGGCAGCCATCACTCGGAAGACGGTGAAGCTCGCCAGAAGATCCTCGTATCTGCC
GCAGACGGAAACGTGTGGGTGGTGACTTTGCCTAGTCATTTGCAACCTATAGTGCGGACGGTGACACGCGAGTTGCTGCTAGAACGCTCGTCCAGTAATA
GTGATGATGGAACGGTGCAATGGTTCTGCCAACTGCCTGGGGTGCAGTCCGTGGATCACAGTCCAGCAGGATCGGGGCAGTCGTCGCTTACACTGATGAG
GAGCTTGGTGACGCCGTCCACTCTGATTGTAAGTACTCACAGGAGATCTGAGTCAACACTGCAGTCCCACCAGTCGCTGGAGCTGGATGAGATCGAAGGA
GAACAGTCTACTTGCACATTTTGTTTGATTAGTCAGGTGACAAGTCATCGTGGGCTGTTGAGGGGGTTGTTTCCGGATGTGGTGATCAACGCGGGTGTGG
TAGCTATTTTACAGGGAGATCTAGATGGTTCTGTGCGATTTATATTGGTACACTATCCGAACACGAAAGGAGATGGCACGAAGGCGTCTGTGGTTCGCAG
CGGGAAACTACTCCGGTTGTGTGAACCGGTTCAGATGATCGTCCCGTTCTCATCATCAGTGCCACCTACGCACTCCTCGGAAGGAGAGAAGGAGAATGCT
TCAACGGATATGTTTGATGCGCTGCTAGTGCTGGGAGCTCGAGGCAAGATTGGGGTTGTTGAATTGAAGAATAGTTGCTCGATGGAGCGCCTTCCTGTTT
CAATTACAAGGCTGGAGCTTGGAAGCGCAGTGCAGTCGCTGGTTTTCATACGCAAGTTGGCAGTATTTGTATTCTGCTCGAGGGGTTCAGCGTTTGTGTG
TCGAGGCGCCGATATACTTGCGAAATCTCACTTCGTAGAGTCAGAAGCAACCACTACTGTCAGGAATGGTTTTATTGTGTCTTCAGAGAAGCTACCTTTT
CGACCGGTACGTGCCATCTACCTCACTGAGTTGAAACATGTGGTAACATGCCATACGTGAGATTTAGGGCATCATGCGGTTAGCAAGTCATGGCAGTGCA
GGTGGTCTGTCGATTCTCTTCGCGTCAGGACGGATCGCAACTCTCGATAAGACAGCACTTCACACGACGGTAGCCAGCGTACTACCATTACTTGGACAAA
AACCAAACTCAAGATGTGATGAGCAACCTGCTACAGGAGAATCAGCGAGTGAGTCTCGCGTTCGCAATATTTTGCATCGGATTGCTCAGATTTCCTCCCA
GTCAAACGCTCTGCGCACCAAATCGAAGCAAATGGACTTTCAGCTCAAGACCTTGTATTCTGCTTTAGAAATGCTTCGAATAATTGAAGCTGCAGGTATG
TAGGATCGGAGGTGATATTGTCTTGTGTGTGTCTCAACCGATGTCGTCCTTGCAGGTGTGGAGTCTGTGGTCAAATGCGACTTGAGAGCCTCGATGGTAA
TGACTGGAACGTTTTCGGATCGACAAACGGTTCAAATGGATTGCTCATTTTGTTTCGTGAATTCCGAAGCTATCATCTCACTTGACGACTGGTAGGTGGT
TGTAATTGTTCATCATTCATTCACATGAACGTTCCTTACGAATCGCTAATTCGCGTAGGTGGTTGTGTCTGTACGTCCGTACTCATCAGCGTGCGGCCAC
AGCGTACTCATTTCCGCTCATGGATATCGCAGCGAGTGGGAAACAAAGTATCATCCTCGACCCAGATGCACTCACACATCAAGATCAGGGGGCTGTGTGG
GTCTCATGCTCAATGACGTTTTGCCCTTCACTGCGTGAAACTTCCGAAAGTGAACGACCCCATTCGAATATCGAAGCACACGTTATTAATCAGGATGATC
CATTGTCGTTCGCAATCCCGCTGTTTCAAGACAGAAGGTTCCTGTTCGTACAGCTGAGCCAGCCCATTGAGGAAGAGATTCCTGCTAGCCAAGCTGCTAT
CCACGCTGCTTTCCGTCAAAAGCAGGAGCCGTTCATGCCAGTGGGTAGAGCCACCAAAGAAGGAAAAGCGTGTTCGTCTGTTCTCTGGAGTGGTGTGCAA
TGGTGGGCTGCACTAGCTGACCATGCGCAGAGAAATCCTGCGTTCGAAGCTTTATGGTCAAAAATTGCGCCTTCAGATGCAGCACCTCTGGCCATAACTC
CGCCATCTCGGTTTGTTATATCCATCCCTGCGTTCTTTGCCACCGAGTACGACGACGAAGATGACGAAGATGAGGATGAAGATTATGAAAAGGTTCGAGT
CGAAAGGATGGCATCATTCCTGCGTCAGCTCCTGGAGATACCCAGCGACGAGGTTCCAAGATTGCGCCGTAGCTGCCGAACACAGCACGGGAAACTCTGG
ACGGTACTACGAGCCTTCTCTGGGAGTCTCATCCTCCTTCGTTTCACGCCGTCTGAAGACCAACAACGATCAGTTGAGCTTGCTATTCAGTGCTCCGACG
TGGCCGACCTCTCCGCGGTAAGCATTTACCATTAGTCTAAACTCATTCTGGTGATACTTACGCTATCATACTGTACAGATGCGAGCTCTTGTGCTGGAGA
CGATCAACAAATGGAGTGAAGGAGGCTTTCGAGAAACTAACGAAGAAGTCCGCTCTGATGAGCTAGCGCTGGATTTTAGTGAGATGCTAGAACCTATTGC
GGCTCTTGAGAATGATCTGGAGGTCTGTAGCTTATTGAGTGGCACTGGTGGCAGTTTATTAATTTTGCTTGTGTTGAGTCGTCTCCCAGGATCTGACTTT
GAAGATTAAACATATAGAAGACTCAAACTCGTTTTGCTGTACGGATGAAGTTCTCCATGCGCTCTCGAAGCTGGCGCATCTGGAGACTCAAACTCTTACG
CTATACTGGAAGACAAGATTGCATCTCAACAGGACCATCATGTAGAAAGTTGTTCATGATTTTGACGCGACAAGAACGATTAAAAAACTATTAGCCGCGT
CAAATTAAAGAATGCGGCTTCCGTCGCAGTGATGCACTTTGGTTTATAGTTCTTCTGTGGGAAGATGCTGGTCACGCAACGACGCTTTCTCGGATGGTGA
CGACACGGAGTAGAGGCGCTACACAATATATAACGCATACGAAACTCAGCGATCTTGGCAGTATCATCGACGTCTAGTGCAGGTTTTCGTACCTCAAAGT
AGCGTGGAGCTCGAGTCGGCCACAGCGTGTAGATGAGAGACAAATAGATGAAGCAGTGCACTGAGGTCGTCATGGCGGACACTGTCTTCTCACGTACCCA
CGGCGACAAAAAAGAAGCGACGAGCACGATGATAGGTAGCGCTACAAAATACACGGAGAACAAGCCACACATCTGAAAAGGTATGGGTGAGAACAGGAGT
TCGAAAGCAAGTACTACTGGTTCCGGTACTTACTCGCAAGAAGAAATATCGCTTTGCCGACGCTTGCTCATAGGAGCGTGTTTCCAAAATGGTGTTGATA
AACCACCCTAGCACGCACACTTGCAGCACGCAGATGCCAAGTCCCGGCCACGAGTCATAGATGTACAGTGTCGACGCTGGGTCGAGCCATACAAGATACC
ACATTGCCATGGACAGATACAGCACCAGAGTCGCCAGTATAAGACAAGAAAGCTTGATCTGGCCGTCCAGTGCCACGCTGTTGATAGTCCATCCTTTAGC
GATCACCATGGCCAATAGTAAAGTGCCGACATGGACAAAGACCTCGGTAATCTTAGCCGCGTATTTAAAAAATGGCACCCCCAGACCATTAAACTCGTAT
GTGGTGAAGTGAATGAAGAGCAGCGCGTTGCACAGGAAGAAGAACAGCACTACTAGTGTCAAGATGCGCATGATTGGATGGAATGACTCGCTTTGTCTCA
TGCGTTGCACCGCCACAATTTGCGCTGCCGCTGCAGCCCCAGCCACTGCCGTCATAACGGCGTAGATAGTCGGCAGTCCTTGCTGTTGCACGGGAAGCTC
ACTTCCATCTCCCTGCGTCATGTGGATCCTGAACCATGAGGAGAAGTAGTATTTGCGGAAGTTGGTCTCTGTAATCTCTGCGAAGGCGGGTTTGTACTCG
TCTCCCCCCGGTACGCACCGCGCAAGCGCCACATACCAAAATCTCGGTCGTAGGTGCTCATGGATATCTACGCTGAAGACGAACGGGGTCACGTGGTGAC
TATTAGTCGCAGTCACGTTATAGACGCCCTTGGTGTGTTGGGCAGAGACCTTGCAATTGCAGTCGCAAGAGCTGTCGGTCATGACGTAGTTCCAGAAGAG
CGCTTCGTCGTCATAGATTGCGACCTGCAGTCCATCCACGTCCGTCTCGATCTCGCCCGTGATTCGCTTGTAGTAATATAAGAGAGGATTAGATTAAGCC
TAGAAAAAATGGGAGATTCCACTAGGTTTTAGTCATACCCCGGCAACGTCGTTGAGTGTGGGCGTCCAGGAGAAGCAGAACTTGCCGATGTACTGGAGCT
GCCGCCCCACGGTGTACCCCGCAATGATGCTGGCTCGGGACGCGGGCACCAGCGCCTCTAGGCTGAGTAGTAGCAACAGGAATCGCATCGTTCTTCTCGA
CCCAAATAATCTGACGATCTTCTATCGAAGCAACTTCAAGAAGGCGTTTGATTGGCTGATGACAAAAGCTGAACCGTTTTCGGTGTAGCCATGTTGCACC
GCAACTGTTGCATTAATTTGTCTTGACTCAAGTTTCATCATGCGTCTCGCTTTCAAGACCAGCATAGGTGTGCTCTAGTGAGGCCTTTGCCAGCGCCACA
TGCATAATTTCTGGGTGGCGCTGCCGGATAGGATCAGAGAAAGCAGACAAGACGTGGGTTCGTGTTAGTTGGCATCATTAGTTGGTATTTGTCATAGAAC
ACAAAGTTTGTGGCAGCGGCGAAGATGGGGCCCTGAGGTAAGTAAAGTTGCTGTTTACAGGCCGGAGGTTTCCGCGTCCGCTGCTGGAAGAAATTATGTC
ATCTTGCTAGCTCGGCAGGCTTTGCAGCCGTCAATATTATCGGGAGCAAGGGCTAGTTTTCTTTGAAGTCATTGAAGTAACGGGTACCAGCACCTTCGCG
GTGTAAAAGTTGCGTTAGCGGAAACTAACTATCCATTCGACAGATGCGCTATCCAGCAAGGTAGCTTCGCGTGTTCATGTAAGTACATGAAGGTATGTGT
GTGGCTTCAGCTCGCTGCCAGCGCACGGATATGTATTTAGCAACGTGAGTGTGTGTCGGTGGCATGAAGCGTCAAGGCTCGTCGCCTTATCGTCGGTCTC
AGAGTCTTTCCCAGCATCTGTTTTCGAGGCTCTTCAGTAAGTGGTAAAAGAGTTCGGAAGGGGAAGGGGACGTTCATTCTCAAGGCAACTCCCGATTGGC
AGCAATTGCAGGAGTCAGTTTCCGTTAGGTCCAGCGCTAAGTGAAGCAAGTCTTGCAGCGTCGAGTCGTGTCGGAAAATCTCGTCGTCGCGTATCGAGAG
GCACACTGTCCAGAAGCCGCTCATATCGCGAACTTGCGCGCTACTACGAGAGGCCAAAGGAGACCAGCGAGGCTCTTCCTCTTCGTCTTATTCTCTCCCA
CGGGCTCCAGCTATTAGACACCGACGCCATCTAGTCAAGTTTTGGTTTCTTTTGCAGCATGACGGTGCGTCGCACGGAGGAGCTGCAGGAGTGGATCTGT
AGCGTCACAGCCACAGCCAACGACCATGGCGAGCACCTTTCGGTGATGCTGCGCGACGGCCAGTTGCTGTGTCTGCTCGCCAACGGCGTGGACCCGACTG
CGAATCTCAAGGTGAACAAGCTCAACACAGTTTTCCACTCAAAGGCCAACCTGCGCCTCTTCCTCGAGTGGTGCAAGAAGCAGGGTCTGAATGAGGGCGA
GATTTTTCAACCAGACGACCTGCTGGACGCCGACGCGGACTTCAGTACTGTGCTTGAGACGCTCTCTATACTCTTCGACAGGTTTGGCACTATCGGCTAC
ACGGGCGAATACGAAGAGGACCCAGTGTCTGATGCAGAGTCTATGACGTCCACAGGCAGCTCGCAGGGAACGTCGCCCGTCAAGAAAACGAACAGCAACA
ACAAACTTACGAGTTTCATGAAAGGAGGCTTTTTATCAAGAAAAAAGAAGTCAAGCAAGAAAGTGGTGGACAAATCCCCCGAGAGAACTCCCCCGTCGAC
GCCTCCACCAATGTCACCGCAGGTTGGAGGGGGAATGATGTCTCCGTCGGGCTCCCCGCCTTCGACGCCACCTCCGAAGGACACAAGGAGCAACAGTGGA
GGTGCCAACGCCAACCGGTTGAACGCCTTCTTAAACCAAGTGCCCGCGTCACACGCGTCCCCGTTGACACATGCTGAGCGTCCGTCAGGTCCGCCCAAGA
AGGCCAACACGGCGAGGAAGCCACCGGCACCAAAGCAGCCAACTGTCAGGAGACCGCCGTCACCCAAGCAGCCTCCCAAGTCGCAGCCTACTGTCGGTGA
CACCCGCAACAAGTTCGCGGCCTTTATGAAGTCCAACCCGCCTGCTGTCGAGACGACACCAGCCTCGGGCTCGTACACCGGGTCTGCAGGCAACAAACCA
CCTTCCCCACCCAAGTCTGCCCCTGTCCGAGGTCGTGACACGTCAAGCGACCAGTTCGCCCAACGTAAGGCGGTCTTCACTCAAGGCAATAGCAGTCCGA
AGCCAGACAAGCCCGCACCTGCTCCGTCGAAGCCAACTGTCAGCACAGGAGGTGGGAACAAGCTTAACAACTTCATGAAGCAGCAACCGTCTGCTTCACC
TGCTTCCTCGACGAAACCTCGTTCGCAGAGCAAGCTGGCGGCTTTCCTGGCGACGACGAACTCGGTTCCTTCTCTTGCGACGACACCTTCTGCCGCGCCA
CCAAAGCCGACGTTTGGTTCGTTCAACCCAACTAAGAACGCTCCGGCTGGTGGTCGATCAGCTCCCAAGTCAACGCACAGCGCCCCTACTCCTGCAGCAC
CGACGCCGTTCAAGCCACGTCACATGATAGAGCGCTCCACAGGTCGTGGCAACTACGTGCGTAAGCGTCAGACGTCCTGGGTGCCTCCTAAGCGTCGACG
CAGCAACTTCAGCTTGGAGAAGAAGCGAAAGTCGTTCATGCAAGAGCAGTTGGAGATTAAGGAGGAACAACTCCGTCAGCAGGCTGCAGGTGCCAGCAAC
AAGCAGAATTTGATCGTGCCAGGTGTGCAATGCTACATTCCTGACAAGGAGGAAGTGTGGCTGCTCTCCGAGATTGTGAACTACAACGATCGTCGAAAAG
AAGTTACGATAACGGCTTTCTTGGACTCGGGTGATTCAGAGCAGCGCGTTGTGGATCTCAAGAACCCGGACGTCATTCGCGCGGTTGCTGGCCCGACAGC
CACCGAGGTGGAGTCACTGCCGGTTGCAATTCTTCACGATAACCCGGAAGGTGTGGAGGACATGCGTCTGCTCCGATACTTGAACGAACCTTCGATTTTG
TTCAACTTGAAGCAGCGTTTCGCCGCCTCCAAGCCTTACACGTACACTAACGACATTGTGATCGCTGTCAACCCGTACAAGTGGATCGATAACCTCTACG
GTGACCATCTGCATGAGCAGTACCTGAAGAAGCCGCGCGACTCGCTGCCTCCACACGTGTACTCAACGTCGACTGCTGCCTACAACCACATGAAGACGAA
CGAAATTAACCAGAGCATTCTGGTAAGTGGAGAGTCAGGTGCCGGTAAGACCGAAACGACCAAGATTGTGATGAACCACTTGGCCAGTGTGGCTGGTGGT
CGCAAGGACAAGACTATTGCAAAGGTCATTGACGTGAACCCTCTGTTGGAGTCTTTCGGTAACGCCAAGACGACACGGAATGACAACAGCTCGCGTTTTG
GTAAATTCACGCAGCTCCAGTTCGACGGTCGAGGAAAACTGATCGGTGCTAAGTGCGAAACGTACTTGTTGGAGAAATCGCGTGTGGTGTCGATCGCCGA
GGGAGAGCGCAACTACCACATTTTCTATCAGCTTCTGGCGGGTCTGCCCAGTCGCGAGCGCAAGGAATTTGGTCTGGATCCTGACTGTCAATACCAATAC
GCTGGTTCTCTTGCGGAGATGCAGATCCCTGGTCTGGATGACGCGAAGTGGTTTGCAAGCACGCAGAAGTCGCTGTCCATCATTGGACTGGACGGTAGTG
CACAAAAGACGCTGTTCAAGATCCTGGCGGGTGTGCTGCTGCTTGGTGAGGTCATGTTCGACAAGAGTGGGGAGAACGGATCGCGCATTTCAAGCGGTTC
GGCGCTGTCCCAGGTAGCTAAGATGTTCGGTCTCCCTACGACCAGAATCGAGGAAGCACTTTGCAACCGTACAGTTATCACTCGCAACGACAGTGTGACG
GTGCCGTTGGCTCCTGTGGAGGCAGCTGAGAACCGTGATGCGCTGGCTAAGACGATTTACTCCAAATTGTTCGACTGGATGGTGGTGAAGATCAACGCTG
CTATTAGCACGGACGAGAGTCGCATCAAGGGCCAGATCGGTGTGCTGGATATCTTTGGTTTTGAGGATTTCGTCCACAATGGCTTTGAACAGTTCTGCAT
CAACTACGCGAACGAGAAGTTGCAGCAGAAGTTCACCACCGATGTGTTCAAGACTGTGGAGGACGAGTACATCCGCGAAGGGTTGCAGTGGGATCACATT
AAGTACCAGGACAACCAGGGCATTGTCGAAGTGATTGAAGGTAAGATGGGTATCATTGCTCTGATGAACGATCATCTTCGTCAGCCTCGTGACACGGAAG
AAGCTCTGGTAAACAAGATACGCACGAACCACCAGACCAAGAAGGGCGGCGGCGTGAACGAGAGTATCGACTTCCCCAAGGTCAAGCGTACGCAGTTCAT
CATTAACCACTACGCTGGCCCCGTCACGTACGAGACTGTGGGATTCATGGAGAAACACCGCGATACACTACAGAAGGACCTGCTTGATTTGATCCAGCTC
AGTAGTCTGTCACTGCTTCCAGAGCTCTTTGAAGACGCTGAGGCAACGTCGGAGGGCGTCAGTGGACGTGGCAAGAAGGCTCCGAAGAGTCTTGGCTCTC
AGTTTAAGACATCACTGACGCAGTTGATGGACAACATCAAGACCACCAACTCGCACTACGTACGTTGCATCAAACCCAACTCGAACAAGAGTCCGACAGA
GTTCAACAAGCGCATGATCGTGGAGCAATTGCGATCGGCCGGCGTGATCGAAGCCATTCGTATCACACGCTCTGGATACCCGAGTCGTCTGACCCCGAAG
GAACTTGCTACGCGCTACGCTATCATGTTCCCGCCGTCCATGCACAGCAAGGATGTCCGTCGTACGTGCAGTGTTTTCATGACATCGATCGGTCGGAAAT
CGCCACTGGAGTACCAGATGGGTAAGACGCTGATCTACTTTAAGAACGGTGTCATGGAAGAGCTGGAGGCCATGAAGTCCGATTTCATGTACTACGAAGC
ACGCACCATCCAGCGTATCGTGTTCGGCTTCTTGGAACGTCGTCGTCTGCGTAACAAGATCCGTGCTGCTATCGTATTGCAGTCGTACGCACGTATGTCG
TTGGACTTCAAGGAGTATCACTTCCAGCGTCGTGCGATCATCAAGATCCAGCGTGGCTGGAAACAATACAAATCCATCCCCATTGAGCCCCAGTACGACG
AGGATTACAACGACGATGGTCAATGGGTGGACGAGGCCGATGACATCGACGACTTGGATGCTGACGAGGGCTTTGGCGATGACCCGGCATCGATCCGCGC
AGGGCGTGGCCGGTCAATTGCGGACAGGATGGAGTCGTTCAAGGTGGCTCACTCGGGTCGTCGTGGCAGCGTGAAGCGTTTGAACGAGCTGTCGGCGCGC
GCCAAGAGCTTCATGAAGCCACGAAGCGGCAGTGGCAGCACTTCGAGCTCGAGTGGCATCTCGTTGGAGGATGAGAACTCGATGCTCAAGATCGAGAACC
GCAACCTGAAGTACGATCTGGAACTGATGCGTGAGCAGTGCATCGAGCTACAAGCCATCATCCTCGAGATCAACAAGAGCCGCAAGAGGTAAATCGAACT
ATCCCTCGCTGCGAGATGTGCATAAAGTCGAAGTCCGCAGCCAGGTGACAAACCAGTTTTAAGTAAACGCCTCAAGGCGTATATCTGTAGCGAAAGACCA
GAACAGTTTTCTCGTTCAACATGTGAAGACATTGAGTAGTTTTCATTAGTTGTTGCTGTTGTTCTGGCCTTGACATCGCAGTCATATTTTTTCTTGCTCT
CAGCGGGAGAGAACATTCGGATCGTGCAACGCTGATGCGCCGTGCTATCCAGATGGATATCATTCTCTCTCTTGTGAGTCACGGGCGACATGAAGATTGT
GTGTGGCTTGGGGCAGCATCCCATCGGAGTTTCGTGCGTGCTTTGACTTACTAGGGAGCGAAGGTTCGAGTTTTTCGAATCGGAGTGGTCAGGAGAGCTC
GCGGCACTGCCGATAAATCGGTGTAGATGGCATTACTGATGCCCGACATCAATCTCCGTCGTGCCAAGGTCCACCTTGAGGTTTGTGCTTGATGCATTCT
TCGTTTTCATCTATCGAGTCTGCACTCGAAGAGCATTCCTATTCCATGACGTTGACCAGTGGATTGTATTGTTGGCCGTAGCGCTACTGGCGCCAATTGC
TTGGCGGAGACCGGCCAGAAGAGCTTCGGCGTTTGATATTTCGATCCAAGGCCGTTGCGAAAGTCAGCCAAGATGCACAGCCAGCAAATGTAAATCCCGT
CGGTTCCGTCGCGGTCGCTCCACGGATTCAAAATCTAGAGCTCGACCCGGAAATGGAGGTCCCCATTGCTACCGTCAAAGAAATTAACCGCGATTCCCAT
GACAAGCGCTGCGTCGAAACAGATTGTGGATCTCTATCGGTGGCACAAAGCGCGAGTTGCAATCAGAAGACGGAGACTGAAGCTGCTGGCGACGGCAAAG
AGAAAGACGGGGACCAGCACAACGAGTTGAATCAAGTGTCTGCTGTCGAGAATGCAACTACAGACGATAATTCAGAGTGTAATCAATCTGCTACCTCCGA
AAGCGCTGACGAATTTCTGAAGTCAGGATCGGAGCAACCTCCATCGTCGACGAGCACAACTGGAACATCATCATCCGTGAGCTCCATATTCAGTGTGTCA
ACGTCTGATAGTAAGTCCAGTTGTGCTGGTAAGCCGCCACTATCGCTTGTTCGTGCGAGCAAAGACAACCGGCCAAGTTCTTCTCCGGAAAAGATGCGCC
AGTCCAAGTATATTTCGCGCATCCAAGGTCAGTTTGGGGCTATCTCTTTGCTGATTGTGCCTAGCTGTTGACTCATTTTGCCGTTCATTTCTTGCGCACA
GGTCCGACGCTGGGCTCTATCTTGCAGCGTATCCATCTCAACGATGGTGATGTTAGTGAGCTGGACTTCTCTACTCTCGCGCAGCGCAACAAACGGCTGG
AAGCTGAAGGGTGCGCTCTTGTGGCACGTTCTCTATCCACTAACCACACCGTACGCAAGCTTATAATTCGGGACCATGCCATCGGAGACGATGGAGCTGT
TGCTCTATCAAAAATGCTGTGCAACAACACGACGCTGGAATGCCTGGATCTATATGGCAACAACATCGGTGATCGGGGAGCTGAAGCATTGGCACAAGCA
TTGTACGGACACGACTCGCTGAGGCGTTTGTGCCTGAGAAGTAACGCGATAACGGATCGTGGCACTGCAGCGCTAGCTCAAGCCATTCGTTGCAACTGCA
CACTCAAGTCTCTAGATCTGGTTCACAACCGAATTACAAAAGCTGGAGCTCACGCGCTACTTGACGCTTTGGACGTCAACATTCATTTGGAAACGTTGAC
TCTGGATGCAAACGATGTACCAGCATTTGCTGCAAGTCAGCTTGCATCAGCACTGGCACGCAATCGTGCTGAGTCTTTAATGATGGAGTCGCATGCCGCA
GAGAAGCAGGCTGTGAAAATTGTACGTAGGGCCAGCGGCTTGGATACCGAAGATGAAGATGATAGTGACAGTGGGAAGGAGGAGAACTGGATGGAGCAAA
TTTGGGAAGATGACGACGGTGATAGTGTGTCGAGTGGCTTCCTGAGTTGCTCAGGTGTCACGGACGTTCCGTTGAGCAGCAGCGGCTTGTGGATCTAAGA
AATGTAGTATTTTCTACACGTCTAACGTAATAAA