Description :
From Genome Similarity Track
Location :
contig_30:126149- 159703
Transcript NameFunction/comments
g6239.t1hypothetical protein
g6240.t1hypothetical protein
g6241.t1hypothetical protein
g6242.t1hypothetical protein
g6243.t1hypothetical protein
g6244.t1XP_009538757.1 hypothetical protein PHYSODRAFT_307593 [Phytophthora sojae
g6245.t1hypothetical protein
g6246.t1ETL32185.1 hypothetical protein L916_15179 [Phytophthora parasitica
g6247.t1hypothetical protein

Sequence
33554 bases(100 bases per row)
CGACGAGCAGAACGCAAAGTGAAAATGTGGCAACAGAACAGTCAATCAATGAATAAATACATTCCAGCGAAGTTTCATCAACCTCATCAACTCAACCAAC
GCTGGCGCGTGGAGGCTTATCTCCATTGAGCCCCCTCGATTTCTGCAAAAACCTCCTAGCAGCTGCCTGGGCAACTGGACTCGACAGCAGTGACACACCA
GCACCGCTAGCACGGCCCTCTTCACGGTCACCTGAGCGCAAGTCGCGTAGTAGCTCTCCGAACCCGCGTCCGTAGCTTAAGTCACTCGAGAAGACGTACG
CCCGCCCCTCTCGTTCGAACAGCCTGCCCAGCGTAGAATCCACGCCTCGGGGCCGCTTCGAAAAATATATTGGCACAATCGTCTTGCCCTTGTCTTCAGC
AAACGCCAACTGGTCACTCACCAGCTCCGTCTTCACACTTCGCTCCGAAAGCACGACCAGGAAAACCGAGCTCTGCAGGATAGCATCCTTCGCTGCCAAG
ATGCGCTCCTTGGTGCTGGAGACATTAGTCATTGAATCCACCACAAACGGCAATTGATGACGACGCAGCTCCGTGCACAAGCGCGTCACAAAGTCGCGAT
GGCAATCGCCGTGCGATACGAAGATCGAGAATGTAGGACCTCCTCCAAACGTACTCCGCCTCCCACTACCGCGCACGACCACGGCATTCACTATATCATC
CAACCGACGATGCTTGAGCGTTGAAGTCCTTACTATTGGTTGCGTGTACCTACTTGCCATCGTTTGAGCAAGTTCTCGACTGCCTTCCAACCGATGCATC
TCAACCTCGTCACGCAATCCGTCAATGAGACTTCTGAGGCTAGCCTGAAACTTGTCCTCATCAATTTCAAACTTCAAACGGTCCATGGACGATGAATCCG
ACGAGGTAGAACTGTTGTCGCTAACTTCTGGTATTTTGGCATGACTGGAAGTCACGGCCTGGCCGAAAGGCACAATCTGTCGCGTGAAAACAAATACCTG
CAACTCTTCAGACATTTTGACGGCTTCACACGATATTGGCACCACCGGTACTTCGTGCTGCTTAGCAAATGCAAGCTCATCCATACACAGTATGCTCTGC
GCATACCCATTTGTGAGCATGCACACGATAGCAGAAGCGTTCTTCATCACCCCCAGCGATTCTTCTGATGCACCACCACCCTCGTTACCCACAGCATCTT
CGTGTTCATCGCGCATATACACTGTCATGAAGTTTTGTTCAATACCAGCCTTTACACGCTCAGCAAAACCGCGAAACACCGGGTCGAATGATAACACAAC
ATCGACACAACCACCTGCGATCTTGACTACGTACTGTAGTTCAGCCGACGCGCAGCACTCGATAGCCCGACGTCCATCCCCATTCAGCGCGTACAGGTCA
GCTTTACCTTCGACTAGTAGAGACAGCGCAGTCTCCTTATAACCGAGCCGCAATGCAATGTGGAGAGGAGTCTCCTCCATTTCATTTGGGACAAGTTCAC
TGACATCCGCGCCAAAACGGACAAAGAGTTCTACGCAATCTCCTCGAAGTAGACCCCCTTCCACAGCAAACGCTAGCGGGGTCATTCCGTCATGGTCCAA
TTGCAAATAGTCTGCATCCACAGCGAGGAGCTCCTCTACTGCTCCAGGATAGTTGTGGCGAGCTGCCCAGTGCAGAGGTGTCCGTCCATGACTGTCCTTA
GCATTGACATCAGCACCGTGTTTCACAAGTTCACTGATGACACGCTGTCTTCCCATCACAGCAGCCCAGTGAAGAGGCGTACGACTGTGGGCGCCTCGCT
GAAACTCGCCTAAAACATCTGGGCTAATGCCCCACGACAGCAAATGGTTCACGGCAGCAAGGTTTCCTGCAGCGGATGTTTCGTGCAGCGGGGTGAGCGC
AACATCAGCTCCCCATTCCTCTAGCACTGCGGCCAGCTCGCGACGGCCCGATAACTGCGCTCGTTGAAGCACAGTCGTGCTGGCAGCGTTACCAGACCCC
GGAACTAACAGAATGTTGGCTCCGTGCCTGATGAGACTTTCGACGACGTCGGCTGAGTCAGCTAAGAAAATCGGGGTGACACGCATCGAACGAGAGAAAA
AGCTGGACCGCGCAATGATGTCCAAGTTGGCCCCATGCTTCACCAGGAGATCAATGACCTGCGTGTGGCCGTGCAAAGCGGCCACATGCAGAGGTGCTCC
CAGTATATGCGTCACTTTCTTCACTCGCAGCTGACACAGCTCGTACAGCAGCTCCAAATTAAACGTGGCGCCAGATATTTTATCGAGAAAGTTCGGGTTC
AGCCCTGCTTCAAGTAGCACCGAAACGACTCGAACATCGCCAGCTCGACACGCCACGTGCAGAGGGTTCTGCGTTCGATGCGAGAACATCCAACATACCA
GTGACGGCGTAGTGTACATTCGATTGAGCAGCATATCCAGCTGCACCTTGGATCCGAGTACGTGTTCAGCGCGCTCCAGCAGTTTCTCCACTGCTGCACA
ATTTCCGCTCGCTGCAGCGTCGTACAGCGCGCCACGCAGCTGCCTCTCGACCGTGCGCACGGTACTCGGCGTCGTGGCCCACGGATGCAGTTCCTGGTTC
AGCGTCAGGTACGTATCCACATGGTTTGCCTGGAGAATGGGTGTGTTGACTCCATTGGGAGCGGAGTTTCTATCGTCACTTCCGGCAGTAGCATTCCCCC
CGGCCAGTGCCGTCGGAGCCACTGCCATCAACTCATCTTCTTCCAGCCCGGCTCCAAGCTGCAACTGCTGATGGGCGCGCAGCTTGTCGAACTGCTGAGT
ATGCAGCGCGATGGTGAGAATGGCCAGCAGCGTCACATACGACACGGGGTCCGTCCAAATGGCCCACACGCCTTCCTCCGTGAGGTCTCCGAAGGCCCAG
TACACGCCCAGCATGAGTACGACGATCCACGTGAGAGAGACCGTTTGCACCACCACAATAGCTTCGAACACGGCCAGCGTCAGTGTGCGCTCCAGCGTCA
CGCCAGGCCCATCGAATGCTGAGCGGGTGAGCGAGAAGGAGCTCACGGCGCGCGAGCCCAGCAGCTGCTCGCTCGTGGTGGCTGCGGTCGTAGACGTCTC
CACAATCGGCTTTTCGGCCTCGTGAACGCGGTAGAGCGGCACGAAGGGCATCGCCGCCAGCCCCAGCGACACGTTGAGCGCCTGCAGACCGAGCCAAGTG
TCCAGCACGAAGCCCTGCTTGCTGGAGAACCAAAGCAGCAGCAGTGAGCCCAGCGACAGCAACGACGTGCAGGCCACGCGCCACGTGTAGTAGGAATTGG
ACCACTGCAGGTAGGCGTCGGCGCCGCGCCAGCCCCCGCGAGCAGGAGGCGTCGCGTTGGAAGCCATCGCGTGTCGGAATGATGCTCAACTCATCGAAAT
CCTGTGAACACGCATAAAAGGTAGTAAATGCGAATTTGAGAGGGGATGACAAATTCCGACCAATAAGAGAAGAGCAGCTGCCAACGGGTCGAATTCCAAT
GCATTTGAATAAGACTGGCTTGTGTTTTGTATGGGATTTCTCGGACGAACGCGGTGGACTATGTCAAGCCATGTGTGCCATTGCTATATGTATTATGTGC
TCATCAAAAATACTTTAGATGGCCACTACGCTCCACGCGATCCTTCGGAGAATGCTTGGTAAACACGCACCATACTCACATGTCCCGAAACGAAACCGCC
CACGATTGGTGGGATATTTAGCCAATCGCAGTCGGCTAAAATCAGCCCGACCTGTCTGACGAAAGCAGCCAGAAACTCCGCAACACAGACAATTCCCACT
GTAGCAAAGCTTGAGAGTCATTTTCCGGCATACAAAAGGCGGTCGTTCAACCAATCAACCGAACGTCCGAACGCGACTTTCACAAGGAAGAAAGCAGGAC
CAGAAGGAGCGCACACGTTGCACGCGCAGCGCTCTGTCGGACCGTCGACAGCGCCAGACCGCAGGGGCTAACAGCAGCAACAGGCGCAGCACACGTAGAT
CTCCGTTTGAGCTGCTCGCACCGACAGCAGACCCGTAAAGCAGCAGGAACAGGTGGACAGGCAGGTCATGGCCAAACGCATTCGAGTGACCAAGCCGGAC
GCGCCCGTGGGCTTCGTAGACGTCGCCACGACGTCCCCAGTGCTGATCAACACTGCGCCCAAGGGAAAGGCCCCCACACCTACGAACGCCGAGGGGAAGC
ACGTGATGCTGCCCGCGTTCCTGTCCAAGACGTACGAAATCTTCAGTATGCCCGAGTTCTCGCACGTGTGCGGTTGGAATGCCAACGGAGATACCATCAT
CGTGTCGCAGCTTGAGGCCTTCGTGGCTATGGTGCTGCCGCGCTTCTTCAAGCACCGCAACTTCCCGTCTTTCGTGCGCCAGCTCAACCTCTACGGCTTC
CACAAGACGGTGCTGGATTCAAAGCGGCTAGAGTTCAACACCCGTACTTTAAGCGCGGGCGGCCGGACCTGCTGCACCACATCAAGCGTAAGGTTTCCAA
CAGCAGCCACCACAACCAGCAGCTCGTGAGCACGTCGATTCAGGTGGGTTGATTGGCGACATGCGATCGATTCGTTGGGTGATGTTCTAATGTCTGTTGA
GTATTTTGAGCAGAACTCGCGACTTGATGCGCATCGGGAGATTTCCGACACGCTGCTGCGGGAGATGAAGGAGCTGCGGCAGCGCAGCGACGCCATGGAG
AAGCGTCTGCGTGACCTGGAGATTGATAACGCGGTACGGGCGACCGGTTCCAGAATATTAGACAGTGTAGCTATTGCAGGGGCTGATTATTTTTTTGCTG
CGATAACAGATTGTGCGGAGCGACAACGTGAAGTTGTGGAAGCACCTCGAGTCAGCGAAGGACAAGCAGCTCATTATGCAGGAGAAGATGAAGAAAATCA
TGTGGATTCTGTTTCAGATCTACCGAGGAAAGCAGCAGAATCTCCCCAAACTTTCTGGCAACGACGTTGCGGGTGCTGTTGTCAGCGAAGAGTAAGTGCC
GAAGGCGTGTTTCTGCCAAATGGAGTATGCAATATGTGACTAACCAGTTTTTGCTGCTGTGTGGTGTTTGCATTTCGCGCCTGCTAAACGTTGGCTTCGA
ACTACCAGTATGCTTGGACCAAAGGAATTCCGTGATGTGTTACGTTTCTTGGCGATGGATGACCCCCCTTTGTTGCCTGGGTCCTCGGCGAATGTAGCCA
CAGCTGCGCCAAGCTCTCGGAAGCGTAAATTTGTCGAGGTGCCACCGGATGTTGGCGACAGCTATAAACTAGGTACAGTTGAAGACACCTTGTGATCGAT
CAAATTTGTTGTACTCACTTGATACTGTTTATTTTCAGATGTAGAACCATCTTCTGTCGTCGAGGTACCGAGCGAGGTGGAAGATCTCAACCCCTTTGCC
ATGACTGTTCCTTCCAACAAGCTTCCTGTGCACACCAAGATGGAGGGCAGAACAACATCCTAAGCATTTTCTCCCCGATCAATGCGATGAACAACAGTGT
GCCCAGCATTGACCCAATGCTCGGTGGATTCCTCACAAATGGTGTGGAGACGGTGCCTAGCATTTCACAAACAAGCGCATCTGCACCGACTGCATCGACA
CCGATTGAAGCGGCCCCTACTGGATCGGCATCAACCGTATCAACCCCGGATGAAGGCGCACCTGTTGCCAGCAACAGGGACTGTACTCCAAGTGACTCCA
CGGTCGCGTCGAATGGTACTGCCACAGAGCCGTCGGCGGATGCAAACAATCAGCTGGCTTTTTTGGACGAAGAGCTGCCTCTGCTGCCTGACTCTCACTA
CAACTTCACCGACGGCGAACAGGTACTGTAACACATCCTGTGGTTATGGTTGTTTGCATGATTACCTTTTTGTGGATCACTGTGTAATGGGGTGTCTTGT
TTTGGACTGCGCATTAGCAGGCAGTGATGAAGAAGCTCGAGGATTTCGAGACGTCACTACTGGACGAATACGACGTCAGCTGCCTCGACACGTTGCTACA
GGTGGGTTCTAATAGGTTTTGTATATGTGATTTTCTCTGGGAGAACATTTACTTAATCTGCTTCTGTTCTTCATTGTTGTTTTTACGAACAGCAACTGAA
AAGCTCTGGTAGCGGCGACAAATCAGCCAGTGTTTCAGTGGCAGATCCGGAGGAGGTTGTGGTGGGACCAACCAACGCGACCCCACACGATGCGTAATGG
AGACTTATTGCGGACCAAAGTCAGCTACCATTGCGACAGTGCTCATGCTCGGAAGCTGGTGGTGGTGATTGCGAGCACCGCCTCATCGAAGAAGTTACAT
ATCCACGTACATGTCAAGCGAGTTGCCGCGTGCGCGTGTCGTCACTGGTAGGAGTTGCCCAGCGCTGCAGCGATGCATGCGTGTCACTACTCTTATCGAC
TGATAGACAAGCGATTGAACACGTCGACTCGCGTCTCCTCGCCCGGTATAGAAACAGATCGAGTGTCAAAAAGTCAAGAGAAGATCAAGCGGAGCGAGAT
CGCGACGCGAAACCAAGAGAAACGGAGACGAGTTCGTACGAACAAACAGCCAACAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCTCCGAAA
CGATGACGAACCCATACATGCGGCTGTTTTTATTTATGCGCAAGAAGCGAGAATCGAGACAACCTAAAACGAGAACAAGAAAAATGGCTCTTCATGTTGT
ACTACTGGACTTCATCCTCTAGGTGTTGGTTCTTGGCGGCGACTAGTAGCTTTATGCCCTTCTAGTTCACTGCGAAGCCGTTGGATCTCTTTGTCCTTCC
GGCTCAGCTCCAGTTGCGCCGTAACGAAGAGAGTTGAGATGTTGGTCTCCAGTTGCTTGTTGGCGGCACCGAGCTGTCGGTTCTGCTCCTGCAATTGCGC
GAGCTCATCTCTAAGTCGCGAGTTCTCCTTCTCCACTTGAGTCTTGAGATCCAGCGCCTCCTTCTTCTCCAACGCGCTCGTGGACGTGTCTAGGTCCCCG
TACAAGTCCTCCGTGCTCATTGTCGCCAATTCGCTAGTGACGCATACAAACTCCCAGCTACAACGCGTCGGATTTAGTCGGAAACCGGTCAATTGAGACC
ATGGACTCGCGGTGCATCAAGTTCTGGGAGGATGGTCAGGTGCTGGTGGCCGCCATCTCCGGCGCGGCACGGGTGGACCAGACGCAGGGCAAGATTTTCA
AGGAGCTGCGAACCATGAGTCGCTTTGTGCAGCGCAACCAGAGCCAGCGCTTCAGCGACGCGGCGCAGCAGAAGCTCGTGGACTGTGTGGGGCACTACGT
GGGACTGGGCAAGCAGGGAGGCGCCATGCTGCCAGTGGCAGAAGCCACGTTTCAAACTGTGAAGGATGGTTTGGCCATGCCGTTCAACGTGTTTGGCACC
AAGCACAAGAAGCGGTTGCTCAAATGGTACAACGAACTTATTACCATCGTAGGCGGAGACGCGGACGCGGCAATTGCTGGAGAAGCTGCCAAGCCGAACA
TCGAGTGGGGCGTCATGGACATTGACGAGGACGGGTTCCTGTCACTCATGCAGGTAGAAAGCGGAGACACAAACGAGAGCTTCCAGGTACAAAAGAAGAG
CGAAGAGTACAAACAGATCAAAAAGGCGCTGGAGAACAACGAAGTTACGGTCGTCACCAACGGCGACGACATCGTGGACATACGCGTTGAAGGAGACTAG
ATGGAAGAAAGCTTCCTACTTGCATGGTAGAGCATAATTAAGAGTAGTCAAAATGCGTCGAACGTTGATCCCATCTGACGTTGTGCTTACGGTGTGATGT
TGCACAGTTAAAACGGACTGGCAGCACCAGTCTTGTCGCGACTCTCACTCCACGCCTTGGCGATCGTGCGCTTCATCTCGTCGTCTCCTTCGTCGTACAT
GTTCTGCAACCAAAGAGGAATGAGTAAATCTGGAGTACATGCATCTCAAACACATTACAAAAACAACGCACCTTCATCATATCCATGATTCCAGCAGACG
GGTCGCTGGTGTCGGGCTTGCTGGTCTTCACCGGGTTCTTGGCCGTGAGATTCATCCATGTGGTGTCCTTGTCAGCCTTGTACAGTGAGACTGTAACGCG
GTTCTTCTTGGCGCGGATCGAGCTCTTGGCAGGGTCAATCTCTTTCTCCAAGTGCTGCTTCAACAGACTACAAGCGACAACAAAAACCCACAAGAACCTC
GTCAGATGTATTCTTCTCACTCCAATTGACCACAACGCACCGGTAGTTCTTGCCATCTAGTCCAATAATCTACCGAACAAAACCACCACCATTAAGTCAG
CTACTCCTCATTACCCATGTTATCCCCATCGAGAAAATCACGAACCTTGAGGTCGAATGACGTCTTGGTGAAATGGCACGTGATGTTCTCCTTGGGCAGG
TCACCGACGCCGTCGATGCCCGACATAACATAGACCGCCACCTTATGCTTGCCGTAGCCGTCGTCCTCCCAGCCGAAGCGACTGATCTCCGTGAACGTGG
TTTGGTCGCCGGCCACTGGCTCCACCTTGCGAGCCGCCACCTTGACGGGCGCCGGCTGCACGGGCGTCTCCGCCTCATGGTGCGGCTTGGCGGCCTTCAG
CACCTTCTGCTTGCGCTGCAGCAGCTGCTCCAGGTCGTGGCGGTTGCCGGCCGTCTTGGTCTGCGCCAGGAGCGTCTGCAACTCCGCCACTTCAGCCGCC
AGTTCGCTCATGATATCCTCAATAAATCCAAATCAGCAAATTTACTGCCAGCAATCGGTAAATTCTAGAACGACACATATATTATACTCAGGACTATTTT
AAACTTGATGTCAGTATGTCTAGCTTCAATGAAACTATGAAGACATATGTTTAGGGTGTCATATTATATTAGTGTACCCACTACGCTTTTCGCGCGCGAC
AGCATGGACGGAAGCGCCCTCGACTCGGTCTCTGCTGAGGCCTCTGGGGGCGTCCCGCTCGTGTCTCCGCCGGCTATAGACGTGGTCGGTCCCTCTGCTG
CGCCTGGTAGCGCAGGACCGGTCACCACGGGCCTTGTACAGCCCTCTCAACGAGCGTTTCGTTCGACTCCCAACTCCACGCCCAAGGGATCCCCAGCGCG
GCTCACAGAGGCGTCAATGGCTCAGTACGGACAGCAGGAGGTGAAGCAGACGCCCGATCGGCCGGCGACGCCAGAAACCGCGTCTTCGGGTTCTTCGCAG
CGATCAGGAAGCGACGCGTCCGAGGGCGAAAAAGGCGGCGACAGGACGCAAAATAATTGCCCAGGAGACGCTAATATGCTACAAGATGGCAGGAGTGATG
GTAGCAGAGTGCAACAGATGCAGGTGGCAGGGTGGATGGCAGGGCAAGGAGTTTCAGGACAGACCAACGGCGTTTTTGCTGTTGCGGCGGCGCCTGCTGC
TCCTGTGCCTACAAAGAAGCCCAAGAGGTGGTTCGATGTCATCCCGATGGTACTGCAGAACTTCAAGGCGCACGACCAGGAGCAGGTTAAACGTACGCGA
TGGATAATGTTGGGATATTTGTTGGATTTTTGCTGACGTAGCTCTTGTAATCTGCCATTTGGGTGTGGGGCTTTCAGAACTGGCGCTGCCGCAGTGTGTG
GTGTGTAAACTGTGCGAGAAGGCTCAAAAGGCGGAGGTCAAATGTCGACAGGATGACTGCAAACTGGTTGACCAACCTTTGTGCTCGAGATGCTGGGAAA
CCTCCCATTCTTCAGACGAGAAGAAACAGCACCGGCAGCTTCCCACAGCAAGTGAGTCATTTTCTTCTTCTTGGTTTGTAATGCTGCTGTACGCTAATCC
ATTTTTCTGATAAAGTTTGCCAACAGTGCGAGGTGGATCGAATTACCTTTTGGTGTGCGGATTGCGACCTGAAGTTTTGTCAAGTGTGTTTCGATCGAAT
CCACAGTGTAACCAAGACGAAAATCCATCGCAAAGTAGCCTCAGAAGGTACGTTTATCGCTGCAAACTATTCACATGCGGTCGAGTTACGCCGGAAAGTG
CTTACTGTTTGCATGTTGTTAATGTCAACAGATGCACCTGGAAGCTGTTTGGTAACATCGGACTGGTCGGAGCCCTTTCAGAATGCAATTATGCAGATGA
TTGCGGCGCGGAAGCATCCACCTCCGGCTTCGGCTGGCAGTGGAGGGGATTCCATCGGTGGAAAACGAAAGCGGGATATTGAAGTAATCGTTATTGACGA
CGATGACGATGAAGATTTTGATGATGCAAGTGCGCCCCCTATCAGCAATGGAATTTCCGAGCAGCATGCTCAAAATACGCAATATGGCATCAACACTGGA
GCAGAGAATGTGGGAGTAGAGAATGCATTAACGCGTTCCAATGCAGTATTCTCGCAACTCCAAATGCCGAACCAGGCTGTTCCTAAAAGCACATTGTTCG
AGCCCCCAGTTATCCAGAACGCTATGATAGAGCCTATTCCGTTTCCTCAGGAGCTGGGAACCGCATCGTCATCGCTATCATCGTCTGCTGAATTTGGATC
GGCGCAGACTAGATCTGTTGGCACAATATCGTCAATATCAACCGGAAACAATACAGTGAACATCAACACAAACGCGGGGAGCTCGCAGTGGAACAACGAA
ACAAGTCAATTTGCAGCATCTGCCTCCATGGGATCAACAGGTTATACCGGCGGGATGATGAGTGTAACACCGAGCTCGACACCGGCTTCTGTAAGCATGG
CAAATGGAGTGTGGTCGACAAATTCTGCCATTAGCACAGATTTGGCCAGCACATCCAATTCTGGCAATCTTTTGCCACTCGGGGGTGCAGTTTTTGCGGA
GAATGCGCTGGTTGATTCTTTGATAGACCGCTATCATGAGATGAACCAAAATGTAACCAATATGGAGCTGCAAAGCGAGCAGCTGACCAGACAGATAGCA
GTCGCAACGTGTCAAGGTCCGTACGCAGCAGGATCCATAATGGGCATGCTAAACAAGTTGCAGCCTGTACTGGAGGCAGCAAGAGAACGACGCGACAAGT
TTTTGATCGCGATGATTATCCAGTCGAACGACATCATGGCTGCTGTGCGACTTCTGCGCTTGACGGAACTCGGTGATGTACCTCAGGTTCCCATGATTAG
CCACCGGAAGTGCCTGCAGATATCCAACGAGATCAATCAGCACAAGAAGAAGCTCCTCGAACTGAATCAGCAGCTGAGTGAGACGCTTAACCTGTCTAAT
GTTGTAAGTTCCAACTGGGAGAACACGCTTATTCGAACTACCAGTGGCAATATTCAGATGCATGAGAAGAGCATCAAGAAGCTGAAGAAGGACCGCGAAG
TGGAAATTGTGCGTATTGTACAGTTCAGCAACAATATCCGCGTGACACTGAAGCTGGCGTTTCAGCGTTCTGTGGAGATACGACGCCAGCATCAGCAACA
GCAGCAGCAGCAACAGTTTCAGCCGTATGGATAGTTTTGCTATCCAGACGTCACGCGAGACTGAAAAGCGAGGAGCGACAACGATGTAGGCAAAAGACCA
ATTATTTAAGTGGCAAATGAATGCACCAGTGTCAACCGTGCCGATACACAAGGAATCCAATCTGCCCCAGAAAGAAGTACAGCATCCTGCGAGCAACACA
TGGTAATGCATGAATTCGAGCTAACTTTTGCATAAGATAGCAGGTGAACTCACTTTTTGACCTCATGCGAGACGAAGGAGCCGAAGGACTTACCTACAAT
GACATGCCACGCACCTCCCTGGGTCTCTTCGATTTCGTGCTTGATTTGCTGCGCAACCTCCGTGAAGTGGTTCTTCTCGCCCTTGTACAGTGCTTTGAGC
GCATTGGTGGCGCTAGTGAGGATGAGCTCCTCCAATTCCTTGGTTGTGTCTTGGTACACGATGCGCAGGCCACCGACAGACACATCGTCCTTCTTTTGAG
CCTTGGACATGACTTTGATCGCCGAGTTGCTGTATCTTTTTCTGTAGGAAGTCGACTTGTGCACGACCGTTGGTATCCAATCGAGACTTGCTAATTCGAG
CAAGTTGGCATTTAGTTGCCGCTAACGAAACGAAGATGTCAAGGGGCAAGGACATTTTCGAGCACCTGGTGCGGCAAACAGTGCATACTGTGCTGTTCAG
CGATACATCGGATCAGCACCATGAATCTGCAAACGATTCTGTTGTCATAGTTGGTCCAGCGACACTGAGCAAAATGCTGTCGAGACGGCAACCGCCATGG
AGATTCGCTCTGATACGCTTCTGCATCGACTAATTCACAACTACGACAACCATACTGAAAACTCATCTGAAGACGAGAGGGGCAACAACGCTGATGTTAT
CAGTTGCACAGCATGGATGAAGGACTGTTTGAACTGGTCCATCGAACGACTCAAGACTGAGAAAGCTTTAATCAAGCAGTACGTGCAGGAGCATCGACGA
AAGCGTGCTGAGGACTGTCACAAGTCTCCCGAGATGCCTGCTGATAACTTCACAATTCACGAGGCATATGCACTGCTCAAGCTTTTTCTCCTTGAGCGGG
ATCCCGACTATCGACAGTGCCTACTGCAATCCATCGAGTGCGACAACTCATTCTTGCCATCTCTCCATGTACAGCTCACACTGTACGCGGCGTACTTCGA
GCGCACCAACGGAAGACCGGTACGACCGTGATGGTATATGCAAGTGTAGTCTCTTATTCAACTTCCGTTTGGCATCCATATTGTAGATCTCCCTAAAAAC
TGACGTGGAGCCTATCCAAACGCTCTATGAGTTCTTCCTCGCCCACCACTGCGCGTCCGAGTAACAGCTAGCCAAGTAAGAAACAAAATGTACTGTCTCG
CATTCGTGGTGCTGTATCGCTGTATCTTGGAGCAACCTACAGGTAGGAGCTGTACGTCGGCATGATGTCGTCCTTCTTGGAGTCCAGACACGGCACCGAC
AGCCACGCGAAATAGAAGGCGGCGCCGCCCATCACGTGCATCAAACCCTTTGCGAACCCGAGCGCCGCGTGGTTGTCGTCGTCGCTGAAGAAGACGGCGC
CGACCCCCACAATTGTCGCAGCGACGAGACAGCCCACTGCATACGCCGCCTTCTGCTTGTTCAGAGGGGAAATGTTGCTGCTCTGCGTGGCCACGCGACG
GTAGATGACGCCGAGGATGTAGCAGACTACGAGGAGTCCCTCGTAGAGCGCCGAGTCCCATCCGTCCTTGGTCTTGAGCAGCCACGCGCCCGCGAACGCC
ACGTAGCGCAGCACAATGTTGTGATTCTCGTCCTTGTAGCCCATGAGGTGCACGCAGAGCAACAGGAAATAGGCCACAGACAGCACGTCCGAGAGGAAGT
GCCACTGATCCTCCTTGAGGAACAGCTGCGTGTCGAAAGCCTCGGCGGCGTTGAAACAGAAGGAAACCACGAGCTGCAGCACGCCCACGAACAGCTCGAA
GTGGCGGCGGTTGCGCTTCATCACGTCCAGCGCCGGCAGCATGGCCGCGTCCGTCAGCGCCAGGAACACGAAGCGCCCGAGCTCCAACAGCATTTTCCTG
TGATTGCGATCGCCCCACAAAAAGTATCTGACTACTCTTTTATCCACCAATCACGTCCATACCCTTTACAAACCGATATCATGTATTTTGAAAGGTAACA
TGAGTGAATGCGAATCGACAGTCGCGTGATTTTAGGAACGAGCCATCAGTGCAAATTGCAAAGCACTTCTCAATTTGCGCAACACTGGATAAGATTCTCT
CCATGACTGCAGCTTCTCCGACGCCTCTGCTGCTGGACGGCAAGGCCACGAGCGACGTGGTCCGTACGCAGCAGCTCAAGCCGCAGTGCGAGGCGTTCCA
GAAGAGCCACGGCCGCCCTGTGGGCCTCGCCGTGGTGGTTGTGGGCGCCCGCAAGGACTCGGCCACATACGTGCGCATGAAGCAGAAGGCGTGCAGCGCC
GCGGGCATCGCGTCCTGGAAGATGCGGATCTCACTAGAGCAGGACGGTAACGAGAAGCCCGCGGAGAAGGTGACGGCGGAGCTGCTGGCGACCATCCAGA
CGCTCAACGAGCGCGCGGACGTCGACGGCGTCATCGTGCAGTTGCCGCTGCCCTCGTTCTGCGACGAGGACGCCATCCTGGCCACCATTGACCCCACGAA
GGACGTGGATGGACTGCACCCGGACAGTCACGCGGCGCTCTTCCAGTTCGCCACCAAGAAGACCTCGTCTCAGCACGACGAGGCGCCGTTCAGTTTGCCC
TGCACGCCTGCGGGTTGCATGGAGCTGCTGGACCATTACAACATCCCGCTGGAAGGCAAGCACGTGGTCGTGCTCGGTCGTAGCCAGGTCGTGGGCCTGC
CTGTGTCGTTGCTGTGTCTGCACCGCAACGCCACGGTCACCATGTGCCACTCGCGTACGCAGGACCTGAAGGCGCGTGTGCTTGAGGCCGACATTGTCAT
TGCGGCTATTGGACGACCGCGCTTCGTGCAAGGCGACTGGATCAAACGCGGCGCCACGGTGATCGATGTGGGCATTAACCCCGTGGAAGACGCCTCGAAG
AAGAGTGGCTACCGTCTCGTGGGCGACGTGGACTTTGACGGTGCAGTTAAGGTCGTGCATGCCATCACTCCTGTGCCAGGCGGCGTTGGCCCCATGACTG
TGGCCATGCTCCTGAAAAACACTATCCAGTGCGCAAAACGACGCGTGCAAAAGCAGTAAAACACAGAGGATACGAGCGACGGAATCCATTCAACGCTTCC
TAAAGTTTGGAGACTCACCCTGGCCCAGCAAGCGAACAAATCGACTTTGCCCGGCTTCGGCTGCTAATCCTAGTTGGTAAGGCGACAATTGTAAGTAAAG
CGTTCCCTGACCCCGTTCACTGCCTGTACGGGCCCGCTAGAAATCGTCGTGATGACCGAAGAGCAAGTCCTCCTCGTCCTCTGACGAGAACTGCCCGCTT
TCTTCTACGAGCTGCACGTCTTGGTGCAGTTCCTCCCAATATCCTCCGTGTGATTGCTGAGCTAGAGGGGCTCCTGTTGCCGCTTCATTATCGCCGTCTG
CAATCTCCAGGTTAGTGTCCTCATCGTTGTCGGCAGCTTGCTTCTCGTGGAGATGGTTCACAGCTTCCTCCAATCGTTGCAGTGCCGTCTTCGCACTAGC
AGGACGAGCTAATGCGGGTTGTTGCTGATGCTGCTCCTTCGATTCACCTGTAGATGCAGCTCCGAATCTCCGTTGGCCCTGAAGCAGTAGTCGCATGCAA
TCAAGTTGACCATACGCCGCAGCGATCTGTGCCGGAGTCTCCCAATCACTGTTCACAAGTGTTGGGTCTGCACCAAGTGACAGCAAATTCTGTGCCACCG
CTGCGCGACCAGAAAATGCTGCCCAGTGCAGTGGGGTATCACGTCTTTCGTCGGCGGCGTTCAAGTTTGCTCCGTGCTGCACTAGTCGAGCAATGATCGA
GAGAGCAGCAGGCGATTCTACCGCGTAGTGCACTGGAGACCGATGCAAGTCATCAAAAGCGTTGGCGTTCGAACCTCCGCCAGGAGTCAACAGAAAAGCT
GTCATGGCAGTATCGTGCGTCAAAACTGCAAGGTGCAGTGCTGTTCGACCTTGTGAATTGCCTTGAGCTTGGAGCATGCAATTCCATTCGTAGTTCACTT
CCGTAGGAACCACAAGTTGCTTCGTGCACTCGACAAACCCTCTCTCGGCGAGGCAGTGCACTGGGTATCGTCCTGCGTTGTCCGGCGTGTGAAGTGACAA
CGCTGCTGGGACAAGTGCTGAGATCGTCTCTATCGGGATAACATTCTCCGCGATTGAGTCCTTCATCATCAGCTGCTGCAAGAAACCACAAATCTCGACC
TGGTCGTCCTCACAAGCTCGATGTAGCACATTTTGACCCTTACGGTTGGTCGCTTGAACGTCGGCACCATGGGCCAACAATTTCTGCATAAAATCCAGGT
GGCCAAGTGATGCATACAACATCAATGGCGTATCACCGTTGCAGTCAACGGCGTTCACGTTCAAGTTTGCGCCGCAAGCAAGTAAGAACTCCAGCATTTC
GGCTCGTGATCGATAGTTTTCCTTGGAGAACGACAGCATATGCAACACACTGCGTTGCATCTTTGGCTCAACTGCTGCAATATCGGCACCTCGCTGCTGG
AGGAAAGTAGCGTCTTCCACGGAAGCGTTTTCGACTGCAGTGAAAATCGTGACTTCTTTCTTCGATGGAGATGATGGGGTAGATTTGGCAATTGGGGATG
CGAGCGTCGCTGGAGCATTCTGGACACTAGTGTCAATCTCTAGAAGCTGCTGGCGTCGTATTTGAGCACGGCGTTGACCCATTTGCCGTAGTAGCGCAAC
AGAACGGGATAACTCCATTTCGTCAACATCGTGATAGCAAAGCTCAAGTCTCACGTTATCGTTGTCTTGCAAGCAAACTGGAGACTTCAGTATCGGCAAC
GCATCGGTCGTAAGTTCCTGAAGAATATGCTGGATTTCAGAGGCCAAATACTCATCGCTTGGCTCAAACAGTTGAAGCAATTTACGTGTCATCTGCGAGT
CAAAGCGAAGTCGGAGTGGTGGGAGTACCTGCTTGGAATCCATCCGCGCACCAGCAGGGGTATTTGATTTCGACCTCTCCCATGCTAGCCAGGCACTAGC
TCTTTTGAAGTAGAAATGAAAAAAATTGCCAGACATCTCACCGTCTAAATTGCCTGTTGTAGTCGCAAGCGAGCGTTGACAGTAGAAATACATCCTTTGG
CGCTTCTGGTACTCGCGAACAAATTTCTGAAGTACTCTCGCGGCATCATGATAAAACAAAATCTGGTTCACACTGCGTGTTAAAATGTGCGGCAGCTCTC
GGTGGCTCCAGTCTTCAACGGTACTATCCACATCAGCTCGAGTCGTATCCTCCTCTGTTGTCTCAATCGGCTCGAGCAAGTCGCACACTGGTTCGTTGTC
CTCTAACGAGTCTATTGGTTCTTTATCACGCGCTTTCTCGGTCGTTCCTTCGTGCTTGAGCACTTTTTCGTTAGGGATCACCACGTCCCCCGGAGCATCC
TGCAACTTTCGTCGAGAAACGATAGCCCTCTGAATTCGTTTTGCAGCAAAAGAGCGTTTAGCCACCAATACCTTGCGCTCGATATCTTTTACCTCCTGAA
TGAGACGAAGCTCGTCATCCTTTACAACTGCGCGCTTCTTTTGTCGTACACCTGTGATCCATCTCCGCCAGCACATTTGTACTTTACTAGCGAACACTGA
TACCATAAGTCGATATTGGCGAATTTCCTCAGCTCGTTGAACTTCCAAGTCAGCCAAATACTGCATCCTGCATAACTTCCCTTTCCAAATCGCCTCGATC
CTTGTCGCTGCACTATTTTCTCGTCGATTTTGGTGGTATTTGTTTACTGCTCGTGCAATGCGTCGACCATAGGATCGATACTTGATGGCATCAAATTGTT
GCTGACGCTCTTGTTCAATGTGTTGAAGTTGCTCAGCGTCGGGTTTTGATCCTGGTACTCCTTCGGCTTTGAGTTCCGCCGTTAAACGTGTTCGGCGGGT
TTTAAGCTCAGCATCATTGCTCTTTTTCCTGTGTCTCTGCTCTAGACAAAGATGTCGCCTCCTTCGCCAATGCTTTTGTATCTTTAAGGCGCTCAAATTC
TGCTTGTGGCGAAGACGTTCGTGTGCCACTTTTTGTCGACGTTGGGAAATCCCCCAGCTTCGCTGAATTTTGAGAGAGCTTTCGTACTGTTCCTGGCGTA
TACGATCCCTTTCCAGCTCTTCTTGTTGTTCATGGTGCCACTTGAGCCACAATGTCTGGATCTTGAGCGCACTCATGTGCTGCTCGTGCTGAATAAGCTC
TCGCTCCATTTTGCGGCGGTGTTGTCGATTTCCCCAGTTTCGTTGGATTTTCAATGAACTCGCATTCTGCGTTTGTACCAGATATTCCTGCTGAAGTTGT
TCGTCTTTGTGATGCTCCAACTCAGTGTTCCTCTCCATGCTTCGTCGCTGCCACCATCGATAACACGCACGTTGTATCCTCGCCGAACTTAGCTGCAGGT
TTTCCTTACACTGCCACTTTCGCCAATTCCGTTGGATCAGTGTGATTGACAGCATTTGTACGCGCTTAACTTCCTCCTTCTCCTTTTGCCACTTGTCCCA
ATGTTTTTGAATTCGCTTCGCACTAAGGTCTCGTCTTATTGTCAGCTCGCGCCATTGACGCCAACATTTTTGGATCTTTCTCGCACTAGCCTGTCTTTGA
ATTCGAAGCCGTTTATTTTCCTCCTCAGCTCGTTGCCACTGCTGCCATCGCAGCCACCTCCTTTGTATCATTTGGGCACTAGCTTCGCGCAAAATTCGGA
TTCGTTCAGCTTTGGCTCGCTGCTGTTGCTGCCGCTTCCGCCACCACCTCTGTATACGAAGCACACTGGAAAACACAACGCGTTGAACTTCTCTTTCCTC
TTGCTTGCGTTCGACCCATCGTCTCCACACAGCCTGAACTTTGCGCACGTTTGCTCGAACTCGTATCGCTGCCAAATGGGCATCGAACGTTTGTTGGTGG
TGGTATCTTCGATCTCGCTCGCGCTTGACCCACCGTCGCCAGGCACTCTGAATCTTGCACACATTCGCTCGAGTACGGATAGTCTCCAGACGCGCGTTGA
AAACCCGTCGTTGTTCATTTCTTCGTTCACGATCGCGGATGACCCATCGTCTCCAGACAGCTTGTATTTTTCGGACGTTGGCACGAGTGCGTAGAGCTTC
AAGGTGCATATCGAACGCAAACTGTTGGGCACACTTTTGTTCTCGCTCACGTATGACCCAACGCCTCCAAACACCTTGAATTTTACGGACGTTTGCTCGA
GCTCGGATGGCTTCCAGGCGTGCATCAAACAAAACTTGTTGCTGGTGCCTTCGTTCTCTCTCGCGTACAACCCACCTTCTCCACGCACCTTGAATTTTGC
GGACACTTGCTCGTGCTCGGATAGTTTCCAAATGCATTTTGAAAGCTTGTTGCTGTTGATTTCTTCGTTCGCGTTCGCGTATAACCCACCGTTTCCATAC
TCCTTGGATTTTGCGAGCATTGGCCCGCATTCGAATCGCTCTCAGATGCGCGTTGAAAGCGAGTTGCCTACGTTCTCGTTCGCGAGTGATCCAGCGCCTC
CACACACTTTGAATTTTCCTTACGTTAGCTTGAACTCGAATGGACTCCAGGCGTGCATTAAACAACAGCTGCTGTTCACGTCTTCGTTCTCGCTCGCGTA
TAACCCAGCGCCTCCACACGCATTGAATTCTACGAGCATTGGCTCGAACTCGGATCATTTCCAGGTGCGCATTAAAAATTCGCTGTTGTTCTCGGCGACG
CTGCTGTTCTTGTGTCCATTTTCTCCACCAAGCATGTAGCCTTCTAGCGAGGGCTTGCCGTTGCTTGTTCTCCTCTAATTGAGCAAGCGCCAGCTCTTGA
GCACGCTTGATTCTTTGATGGTGCGTCCATCGACGACACGCTCGTTGAACTTTCCGAGCACAATTCATGCAACGCAAGTACTTCAGCCTGGTCGACTTGT
GCTCCAATTCCTTGTGAAACCTAGCGACAGTATCAAGCGCCAGACTCACACCTTTGCGACTTTCACACTCTGCAAGAAGCTTGACTGCAATGATAACTTG
CACTAGTTGGGCTCGAGTTTGCTCAGCAATAAGCTTATCCTGAGCAGACTTTTCTTTTTGCTGCATTCGTATCATTCCCACGGTTCGGTTATTGCGATGT
TGACTGATGCGTTGATGCATGAAGCTCGAAGCCTTAATCAAGGCAACTTCGTGCGTCTTCGCTTCGATCTCTTCCCTTTGCCTTCGTTTCTCCTCCTCCA
TCTCATGTACCGCTGAGGCACAGATTGCAGCCTTTTCCTTCTTGAGTTTTGAAAGCTGCATCTGTCCTGAAACCCAGGAAGCGATCACCTGCATGCCAGC
CTCGACTCGACTGTGTTCCAAAAATGCTGCTGCTCGCTGGGCTTCCAGCTGCTTCTCCGCTGCTAATTGATCCTTAGCTTGTAAGAGGGCTTCAGAGCGT
GCTTCAAGCTCAGATAAGCGTCGTTGAAGCTCAAGCGCAAGCGTTGTCGCTGTTCGTCGCTGTTCAAGCTGATCTTCGCAGGACATCAACTCGATCTCCA
TCTTCTCTGCTTGAAGGTGTGCCTGTTTCATCAAAAGTTGATGTTTCTCGCTTTCTGCTTTCCTGGATAGCGCCCGAGCATCGATAAAACCTTTGATCTT
CTGCCTAGCAGCACTCTCTTCTGAAACCCTTTCTCGTTTTTGATGGGCTTGAACAATTTTGCGATGTCGGGCGTCACTTTGCAGTGCTTGTTGTGCCATC
CGATCAAGTTTGCGCTCGAGCACACGCACTTGGGTACGCGTCTTGTGAACGCGCTTCTGGGTTTCAATTCCTAGTTTCTCCTTCGCAAGCAGCTCCTTCT
GAAGCTTAAGCGCATACTGTTTCTTTTCCACCTCAACTCGCTGCAGCTTCTTGTGAAGAAGGCATACTCTGAAAAACATTTGAATCTTCATCGCTGCCAG
TCGGCTTCGTCGAACCTCAACTGCATGCTGCTGTAGTTGTACGACGCGCTCATGGTGCGTAAGCAGTTGCAACCTTTCTTCCTCTGAAGCCTTCCATCTG
CGATCTAGTTCCGCCAATCTAGCGTCCATATCCGCAATCAATTCACGTCGATGCTTCGAATTGAGCTTCATGGTCTTCTCCACGTCTCTCTTAGCTTTTG
TCCACTTTAGCTGCTCCTTGAACATAATGTTCTTGGTCAACTCTTGAGCTGCTTTCAACTTGCGGCGCAGTAAAATCTCCATTAAAAACCTTTGGATGTC
TTTCAAGGCTCTCGCTCGTCGTTCTCTTTCTCGAACGATTTTTTCTCGACGCTGCTTTTTCTTCTTGACTTTCGAACGCTGGTGTCTCCACCACCGAACC
ACTTTTTCCTTTGCATATTCTCGCTGTCGCTGTCGAAGCGAAATGCTCACGAAGAAGAGCATACGATAGAATCGCATATGGTCAACCGGAAAACAACTTT
GCGTCTGGCCACCTCCTGATTGTGGAGGTATATCCTCCAGTTTCGTTGGATTCGACACGCAGCGATCGATCGGACACGATGATCTTCATCTCTTCGAGCT
TGCAATCGTCGTTGATGATGGCAATAAATAAATTTCTTGATCTTCCGCCATGCAACTGCTCTGCGAACGACCTGCTTTGCTCGTTTTTGCTCTGCGCAAG
CCTCTTTCCAGTAGGTAAAGTTTCGACGCAGCATCTTCAGCTCTCGCTCCAAGTACTTTGGAGCATTCCCAACCGGAATTGTAGGCGATGCATAGCCCAT
TAACGACGAGTACGGCTGCGCTACCGACAGAATGTGGTCTTCGACCTCGCGTTGGGACACCCAATGACTCATGTCAAATGCTGCAACTTGAATATCTCGA
CAAAGTGAGAAAATTCGGTTGAACTCGGAAGGTTCGCTTTCATCGTCACCCTGATAACTCGACGATGCTGAAATATTGCTGCGTGATGAAGGAAAAGGAG
AATGAGCTGCCTGTCCAATCACCACTACTCGTGGGTTACTACGTGATGAAGCGGGTGTCGAATTCATCACCTGGTCGCTTATCATCGTTGGTGCATCACT
ACGGGATGAAGTTGGTGAAGAATACGCCGCCCGTTCGCCTGTCGCTGTTCGTGCATCATCAGTACGAGATGAAGCTGGCAACGAGGGTATCGCGTCGTCT
CTAATCATAGTTGATGCATTGCTACGCGATGAAGACAGCACCACATCTCCGCTCGCCATCGATGGAGCTCCATAGCAAGACGAAGGGGGTGAGGAATATG
CCACTTGATCTATGGTCGTTGTCAGCGTACTTGTACGAGATGCAGCAGGAAAAGAATGCATCACAGGGTCAGATGCCACACTGCTACGGAATGAAGATAA
CGAGAAATACGCAGCCATATCGTCGACTGATGAACTGAGATGCACTGCGTTTTCAAACGGGGACTGCGCTTCATCAATCGATCGGTAGCTGTTAATTCTG
GGAGAATCCAGACCCTCATGGCTCTCGGTCGGATGTTCTGATTCCCCTTCAGGAATTGCGAATGCGTCGTCGTTCCAGACACTTGGAAGTAAGCTCAGAG
CCATCGCGATGTTCGAAACAGCACTGCTTGATGAGTACGCATATTCATCGTCATCTGGTGTCGCTACCTCTGTTCGTTGCTCAACGCTCTCCGTCTCGCT
TGTAATGCTTTCCATCGAAACGATAGCTTCACTTTGCATAGATCTATTCGTTGGAGCAGGAGATACACCAGCACTGGATAGTATCGCTGCCATTGCTGGC
AGAACCTCGCTCTCGACATGATCTGCTTCAAGTTCTTCTGCCCTACTTGAATCCAAGCTTTCAGCCGCGTTGGGTGGTATTGCTTCCTCAGGCTTCAAGA
CTTCATCTGTTAATGCAGACTCTGAAAAAGAAAAACTCGGTAGCATTTGCAGCGCCATCGCTATACTCGACAACGCCTCGTTCGATGAATACTCAAAGTC
GCATTCATATCCATCGTCATTCAACTCGGCATCATTTTCCGCGTCATATTCAACGGACGACTCCGTCTCAGTGATTAAAGCCGCTTCAACATTCATCCAG
TTGTCCATAGTATTACGTGAAGAAGTCAATTGTTCAATCTGGAAAGAGGAAAGTAGAGCATCAGAATCTAAAGCATTGAACAGCATTGGTTCTTCGAGGC
GTACAGAATGTCCACCCTCCTCCACCGATTCCGAAAAATTTACTTCCGTGATGATCGGGCCTGACACAATATCCAAGTTATCGACTTCTCGTTGAGGTTG
GTCCTTAGTCACAACAGGTACGGATGGTCTCCTCACACTAACCAGATTTCCAGGTCCCTCTTCGTAAACCTGCATCGTTTCATCTCGCGATGATCGCGCG
GACAACGTACTTGCTGATCGTTTCGTCATCGGTATCTCGTCTTTCCCGCTGGCAGCTGCTGGCTCGCTCATTTGCATTCCAACATCGACGAATGTGCAAC
GATGATCGCATTTGTCCTCAGAGTTGCTGCTTCTCTTTTTGGACGCAGGTCGCTCCGAGTGAGTACTTCTGCTAGAGGATTTTGCTAGCGCTGCTGTATC
CAGTGGGGGAAGTGGCAGCACTAATCGAGTAAGTTCCACGGTGTCATCCTCCCCTCCAATTCCAGTATCAACAGTTCTGGCCGACATTTTCCTTGCAAAT
CGGTGAATGTCCGATACTGGTGACGCAGCACTATCCAAAATGGTGTTTTCTTTCCCGGTAAATCCTGAATCGGGTGGACTAGAAATTGGTGTCCATGCCG
ATGTTGGCGGCGTTGCTGACCTGGCGTTCTCGTTCTTTGACGGTCTTCGAACTGAGGCACTTGAGGTTGTCGATGGCAATAATTGATCGGGCACAGTAGG
GGTTAAAGATCGTTCAGTAGGTGGTCGAGCGTCCAATTTCGCTACGGTCTTCGATGTTGGTGAGCCAGCCCACGCCTCCACTACAGTTTTTTCACTTTGA
GATGTGTCTCGCCCGCCTGTGTAAGCTAGTCGAGAACCCTGACGATCCAACCGTTGTATCCGTTCATCTTCAAATGTACCATATCCATACGACACATTCT
CTGGCACACGGTGTTGATGCAAGTGCCTCCTATGCTCTCCATGAGACTGCAGATATCTCGGTATCATTCGAACAGCATTGTACCGCGTCTCAAGGTCCAT
CAAATGTAGCAATGCTGCTGCCACACGTTCTGCTGGTAAAATTTGCCAACCTTGGAGGTATCGTTGGGTCTGAAGCGCAAACGTCTCCAGTTTATGAGTC
AATAGCCGCAACAGAGACGTCGATGACGACGAAGCAGAGCAAAATAAGGCGCCGGACGTTGAACTTTGATGACAGGAACAGAGCAGCACCTCCGATGAGT
CCAAGGATAATCCATCTACGAATGGATTTCGCGTCAAACTCACTTCAAAGTCCTCGAAAAAGCGCTGTAGCGGTGGTGAACACGCCAGGAAGTCCGAGTC
GGAAGATGCCATCTGCAGCAAATACCCGTAAAAATCTTGCTCCAGGATTTCGTGTTCACCACTAACGCCCACGACATCAGAGCCGCCAAGCTCACTGCTT
AAATACACCACTGCCTCCACCACCGCAAGTGCCAGACTGCGCATCCTATTCAGCAGCTTCACCACTCGCTGCGGCACATTTTTCTCCACGTGCGATGCTC
GATGCAGCGGCAGTACCCCCATGAGTTCTTGCTGTAAATGGGCCATCACTTGGTCGCGCAGGTGCATATTTTGTCGAATTGAGTCGATCACAATCTGGGC
TGGCGACTGCTGTAATGGTGGCGAACGAGTCGCGCGCTGTACAGAGTTTGCATTGCTGTTGTGAGGAGATTGCTGGTAGCGGTGAGGTGCCGCGTCACTA
CGAGTGCCTTGCACCTGTTGTTTGAGCTTGTAGGGACTGGAGAGCCTCCTGGCTTGAAGCTGCTGCATCTGTCGCTCCGTAAGAGGTTTGGCCGCAGATT
CTCGAGCAGCTCGTGTCTGCAGTCGTGGCTTTGGTTCTGCACTGAAATCTTGCTCATTTCCAGGCTGGAGACTTCGGCTGTTGTTTAAGTCCCCTGTGTA
GGTCGTTCTCCTGCTCGAAGGAGCCTCCGACTGCCATGTCGCAGTTTGCTGCATACCCGCTCGTAGGGTGCCTTGGTACATCGAGTCGTCAAGCTCCAGC
TCCACTAGAAGACGTTGCTGATCATGACGTCGACGGCCACCGAACTCCGTAGCTCTGCGCGGCGGGGGGCTTTTCCCACCCCACAGGAAGGTTCTATCAG
CCATAGCCTTTTATAATTAGGCGCCACTTGCCAAATGCCCACTCTTCCTGCGCGCCGCTGAGCGTTTCCAAGAAACGTTTCGTCGGCGAGCTTCTTCATC
GCAGACACCTGCACAAAAACCAACAGGGTAACGCAACAAACACAACACTAGACTGGATATGGGTGTCTTAAGTTTTACCGGTGGGACGGTGATCGGGATT
AGCTCCACTTGTTCCTAGATAAGCATATCGCCGTCCTCCTCTTCCTCGCCAGTTGTCATAGTCGTCAGTCCCTGGGCTCGGTACAGATCAGCAATCTACA
GGAAATAGTGGGGGGAAATGAATGGTAAACAAGAGTTAGTACCGGATCATGAGCAAACACATTCAGTGCCGGAAACCAGAAGTTCGAGCGGACCTGTGAA
GAGTTGGTCGCCTGCGTAGTCTCCTTGTCGTCACGGATGCGAATGAAGCGAGGGAAGCGTAGGGAGATGCCCTTATCCTTCGCCACTAGGCCGATGGCTG
CCGTGTATTTGGGCGAGATGGACAAATCTGCGCCTAGGATCTCCCACACGCAGCTAGCTTCGAACCAAACGTCAGGCTTGATTCCTTCGTTGACAGCATA
ATCGCTTGGCGCCTTGTCGACCACTTTCTCCTTGAGCTGCTCGTAGAACTGCTTGAGCACTTCATCCGACAAACCGGTGCCCAACTTTGTAATGGGTTGG
TACATCTCGGTGTCCGGGTCGTAACATGCAAGCAAATACGCGCCGTAGACACCAGTACGTTTACCACGTCCGTAGAACGCACCGATCGGAACCAGATCAG
CGGAATCGCCAATGCCGTCGAGGTAATCCTTCTTTAGCTTCAGCCACTTGTGCGAACGGTTGGCCGGTTCATATGTCGCCTCCCTCTCCAGGGTCTTCAC
CATCAATCCTTCACAGTTCTCACGCACAGCCTCCTCCAGGAAATTGCGGACCTTATCAACCGCCTCTTCCATCGCCTCCGCATTATCCTTCACGTCGACA
CCATCTTCCACATCTAAGGAAGTAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGGGGTGCCCA
GGAATGATTCGCCGTTCAGGAACAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGTGCAAATAA
AATCAGAATCCAACACAACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCTTGTTAGTG
ACGCGGTCCACCGCAACCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGGGAAACGCT
CCGTGGAGTTCTCAAAATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCGCAGGTGAA
CGGCTTGCCCTCAAACCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGCACTTCTCA
GAAACATTTGCGAAATCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCTTGGGCACT
CGGAGAAGGCTTTCTTGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCCATCAGGAT
AGATTTTTCGGCCAAGCCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGGCCTTCTTT
TCCTTCTCACACTTCACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTGATTGTACA
CATGCTGGACAGTGAGACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGATCGCGCATTCTGCGCAACCTTACC
GAGATCGCCCTCCTTGTTGTACATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCAGGATAGCGTCACCAATGCCGATC
TTCAGGTTCTCAAATGGGGGCGCCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACGACGAATGACGTCACGGAAGAATG
CAGTGAGCAGGTCTTGGATGACGAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATACGGAGTCTCACGGGGTCCGTCGCT
CTCCTCTTCCTGTTTTTCAGCTGCGTTGGCCTCCTCTTTTTTGCTCACCTTGCTCTTCGACTCGGACTCCGTCCCACTCTTTATTTTCTCTGTCTTCTTA
CCGTTAGCAGGAGTCGTCTTGGTATTCTTCGCAGCTTGCAAGGAGAAGAAGCCAGCTTTCGTCGAAGTAGGTGACAATGCCTCCTTCTTCGTGTCGGTCT
TTTCAGACGCTTTCTTCTGCTCAACCTCTTCAACTTCCTCTTCTTCAGCCTCCTTCTTCGGCGTCTTCGTCTCCTTCTTGGGACTCTTGGTCTTCACTGG
CGTCACGGGCTTCGTCTCTTTCTTATTGGGACTCTTTTCCTTCTCAGGTGACGTCATGTCAATCACTTCCTTCTTCTTCTTCAAGGCCATGGGCAGATCC
ATGTCGCTGTCTTCATCTTCCTCCTCTACGATCCGTTGCCGGAGACGACGACGACCAGCTGCAACAATAATAAAAACCGAACAGATAATCAGCCACGGCC
ATATACCAGCAGCAAAATAAAGAGATCCACGTACGTTTCGTCTTGGTGGCTTCTTCTTCATCTTTTTCGTGTTCTTCTATGTGTTCTTCTTCCTGCATTT
CGACGTCCTCGGGCTCTTCCTCCATTTGTTTCTCTTCCTCCCCGTCTTGTTCTTGTGCCTTCTTCGCTTCTTCTTGTGTCTTCTTCTCTTCTTCTTCTTC
TTCTTCTTCGTTTTGCTTCTTCCTTTTCTCTTGTGGCTTCTCTTTCTTCGCCTTTTTCACGGGTTTATTGGCGGGTTTCTGCGCCTCGTCGTCCGCCGGT
TTGCGCTTCTTGGGGGACGACGTGGGGGCCCCCGCGCCGAAGAACGACATGATGGAGCGCTGCGTCTTGGGCGCAGCTAGTGTCACGTGAGCACATTTGT
ATGTGAGTGAAATGGGTCTCCCCCAAACAGCCCAAAATATACAGCACCTTTCTTCCCCATTGTCACTCCACGTTCGCTTTTCAGCAATTGCAGCCAAAAC
TTTTTGGCGCGCTCCAAAGTGTACCCATCTCAAGCGGTGTCAATAGGCGGATAGTGGAAATACAACAATCCTATTTATTTGGCGGGAAAGCTTTAAAAAG
GGTATCCAATCGTCAGAAATGGGTCGCAAGTTGCTGGCACTCGTGCCGTCGGCGCTACCGGCGTCCGCCAACCTGGAGCGCTTCCACGCGGATGCGACGG
ACGCTCCGTTGCTCTCAGTGGTCGTGTGGAGCTCCCACGGCCCTGGGGACGCCACGCGGACGCGTCAACTCGCGCTGGACCGCGATCGGCACCGACTGCT
GGAGCTGCAGCGCGTGCAGCCGCCCGATGGCGCGCGGAGTTGGTTTTTGGGCAACTCGGTGGTGCAAAATGGTTCCCTCACGCTGTTTTCACCCATGGAC
GCGCTTTTTGTGCTGCTGGACGCTGCATGGGCCCAGCGCAAAAGGTTCTCGTCGGTGTTTGACCTTTTGGCGCAAAATGGGAACACATGGCTGCTGCAGC
TCTCGACACTAGACCAAAAAGTGCTGGAGACGATCTGCGACGTGCAGACGGTGGGAGGAGAAGACGGGGTGGACAACCTCTATGTGAAGGTGAATGCGGG
TAAAGTTACAGGGTGGTTAAGGTCCAAAGTGGAGAAGGTGGCTGCAGTGCTGGCCACGCAGGAGAAGACGGCGGCCAAAGGTGACGCGTTCGCGGAACAG
GTAAATGTACCAGGACAAGAGGGAAAGAAAGAGTGTGCGGAGGTGAAAGAGGAAGTCGTCGCTCGCCATTATCGCGAGGCCATTGGCGTGGTGGGGAACT
ACCTCCCGGAAGAGTGGATCGAGCTACTGTGCAAAGAGTTCAAGTACGTTGATGAACAGAGTTTTTGTGTTTTTTTGTTTGTTAGCTAAACGAGTTCTAT
TTGTTGTTCTTAAGGGTGGAGACGGAGGTGGCGGTGAAGACTCCTGCCAAGTCGGCAACTGGTGCCCAGGACAATTTCAGGCGCTTCGACCGACGTCAGA
CACCCGAGAGTGGGTCCAAGCGCTCGACGCCTGCTACGGCTGCTGCGACCAAAAAGAAAAGCAAATTGGCTAATGTGGATCGCACCGGAATGAAGTCGCT
GACCTCATTCTTCGGCAAGAAGTAGAGAAGTTGCAGTTTTCGTTGCATTTCGCAGATATATAGAGCTGTTTATCATCTACCGTCGCGATGTCGAGCCCTC
CACGCTCACCCGGTGCACTTGCACGAAATCGCCCCAGCCAGAGAGGATCCTGAACTTGATAAAGGAGGCATCCGTTGGCTTGACATTTTCGCTTACAATT
TGCATCTCTCCGTCGGTCTCCTTGAGCTCTGGTAATGGCAACCAACCATTAGCTGTAGAGCACCAAGACAACCACATGATTTACTCACTGGCATCGAAGA
GCTTCTCCCATTTGGTCGGGGTTGGTCCACTGCAGGCTTCTACGGACACCTCCTTGACATTCCGCGTCCACATCTTGGCACGAACTACAGAAGCCGTCGT
TGCAAGCTGAACCACGAGTTCCTGAGGAAAGCTTCCTGTCGTCACCCACTTGGACGATTGCTCTCTGCAACAACCAAGGCAGCAAGGTTACAAAAGTTTA
CAAACGCAGAAGCAGGACACACCATACCCGTCCAAGATGTTGACCGGTGGGAAGTTCGGATCATACGAAGTCACCGCCGTCACCTGGGCGCCCTCTTCAT
CCAAAGCGAGCTCCATCGCGACCGAGACGACTAACAGACTTTCGGGGAACTCGGCTCTTGTGATTGTGGTCTGCCTTCTGTCCTAAAAACCGCACAGCTT
AAACTTAGAACGACGCCACAAGAACAAACATAAGAATAGCTTGGGACGCACTCATACTTATCATCTCCATTTGCACAACGCGGAATGCACAGGCGACTTT
TACTTGAACACCCTCCTAGATACCGACGTCGCAGGCCACAGCGGGTGGCTTTTTCACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTCTGCAGTCGCGGG
CTCTAAATCATGTTGGAGGCTGCCCAAAACCCAATTCACTGGACAACCGCCGACCTACTTACGTTGTCAGCGGTGGCTCAATTGACTCCTTGTACAGCCT
CTCGAAACCCGCCGACAAAATGTCGGCTGCACGTGTGATACCCGATCCATCGTCATTAAAGAGCTTGCAGTTCGACCACATAAGGCGAATGTCGTTGGCA
AAGTGCGTAGAATCAAGCTCCTTGACACCAGCCGCCACTGTGTTGCTGTCCACAATGTACGCTCCCTTCTTCAGCTTATCCTCGATTGTCGACAAGTCCA
TTGGCTGCTTCACCACCCGAGTGTACATCGGAATGTTCTCCACGGGCGTGAGGAATGGCTTTGAAAATGGATGCGACTTCAGACACGTGACAATTTTCAG
GCACTTGTCCAGCAAGCCTTGCTCTGAAGCCACAGCTGTGGAATACAAATCGAAACGAGACGGCTTCCGACACTCGGCGCATTGCCAATCCCCCTCCGGT
AAGTCACTCTCCTTCATGTGCAGACACTTTAAGTGGAAGGAGCGCGGGCACTTGTCGCAGCACACCAGATCACCAGCACCCTGACAGACCTCACAGAAAT
CCAAGTTCGTGTCCAGCTCGCTATCTGAATCATCGCCCTCGTCTTCATCATCTTCGTCGTCTTCTTCGTCCGCTTGGTTGTACGTTTCATCCTCTGTTTC
TTCTTCGTCTCGTTTCACTCGCTTGGCATTCTTAGGAGGTCTACCTCTTCCCCGCTTTGGGGGCGGAGTAGATTTACGCTCTTGTAGATTCTTCCTCTCT
GCACGAGGACCAACTGAAACACTGCTCGGTGTATCGTTTTTTAGCTGGCGCGGGCGACCTGGTCCATACGCTGGTGATGACTCCGCTGAACGACTTTCCT
TCGGATGACGTTGACGAGCAGGGCCGTACGCCGGTGACGATTCCGCTGAACGGCTTCCCTTAGATCCCGCCTCGGCTGTGTTTGCCTTCACACTACCATC
TAGCTGGGATGCAAGTTTTGATCTTGCATCAGGCGGATATCGGTTTTTCTCCTCATCGTTGTGTTCACTAATAGAGCTTTCATCGCGGCGCGCTAACCTT
GAATCGTTGCGTATATCGTTTGAATTACGTGGCGCTGGACTGTCCTCCGCATCGCTTTCGCTTGCTTTCCGCTTCCGTGCGTGGACTTCTTCTGCTGACC
GTGCACCTGCACTGGAGCGATCACGAGAAGTACTTTCGTCTGCCGAGTCCATCGAGCTGGTCGATGATTGATCTTGATATGGGCTATCTGCTTGGCGGCG
TCTGTTGGCAATACCTCGTTCAGCAGTCAACCGAGAGGAAGCTTCCATTTCATCGCCAGAACCTTGATCACCAGAATCTTGCGCATATCCACTGCTCTCC
TTCCTAGCTACAATTCCATTCGTACCATAGCGTAATTCAACCTGGCGATGGGTGCTATCTTTGCTGGATTGACTGCTGGCACTCAGATCCATCGCCATCG
ACGAAGGCTCCGTATCTTGGTTCAGCGTGCTTAATAGATGGACCAGTGACTTCTCTGACTCGGCACAATTCAACACAGTAGCCGCAGTTGGTGACTCCGC
TGAACCTTGATGAACAAGCGGCGAGGCGATTCTAGCAGCAACTCGGGGATCAACAGCGTGCACACTGTCAGCGATCACAGACAGCATATCAGTAGGAGTA
TCCTTTGCCGCACGCTTGGGAAGAGGAGGGTAACGAGGCAAAGGCTTCTGCTGCGCTTGCATATTTGGTGGGTAGCTATCACGTTCGCCCGCCGGATACT
GCCCGTAGTCGGACTGCTGGGTCGGTATTTGCCTGTGTCCCTCCCACGACCTCCCGTCCTCAACACCGCGAGCAGAAACTTCACCGCGCACAACGGGTGC
ACGACCATCACCTTGTGGGGTGGGCGGGTATTGAGCGTAACGGTGGCTGTCGCTGCTTGCCACATTTGGGGCACCGCTGAACGAAATTCGGCCATCGGGT
CCTGTTGGGGTAGCTGGAGGCGCGCGATTGTCCTTCACAACGGCAGTGCCCCCCTGTCCATTGCGACGAAGCGTGTCCAGGAGATAGCGCTTATACTTCT
GGACTTCCGTGACTTTTACCTGCGTGCACGAGGTGCACGGACATCCACTCGTGCAAACCAAGCAGCGCAGCAGACGTCGGTTGGGGGCAGAGCCGTTCCT
GCCCACGAACAACGCCTCAAGCCTCACTCTGTAGACACTGCGCAAATGCTCGCGACACAGAGAATGCCCCTCATCCGCATGCGGGCAGAAATTCACGACA
GGCACATAGTGGCTCTCGCCCGCTCCACACAAATGGCACAGTCCCTTGGCCACAAAGTTGGCCTCCTGCTCCGGAATCAAGTCCTCCATGGCCACAGCGA
ACGCATCGTGCAGTACGGACTCGTCCAAATTCACCTGTTCTCGGAGCATCTCCTCTACTCGAGGGGGCAGCTTCCTCTCTCTCTTGTAGTCCTCCGCCAT
CTTCCCCTTGAATCCCGTCGACGCCTCCGGCAGTTGCTGAGACCCTGTAGGGCGTTGTTGCATGACCCTCTCCTGATACATATCCGCTCTCCCCTGAAAC
CCTGTCGTTCTAGCATGGTACCCTGCAGTCGTTCTACCTTGGTACCCCGCCGGCCCTTGGTAGCCCGCTGCATCCACTGTTCTCGCCTGCGCGTAACCCG
TAGCCATTCTCCCTTGTGCGCTGTAACCTGTCGAGCTCTCAGCCACTCTCCCTTGGGGTGGGTACACGGTAGAACGCTCTACCGTTCTCCCTTGGTAGGT
AGAGTACTGCTGATACTGTGGGGGGGGTGCCTCCCGGTCCGGGGCCCTCCCCTGCCAAGCCGCGGCCGCTGTGGCAGGGACCACTGGCCCCGACGTAACC
GGTACGTAACCCTCTGGCGCCTTGCCCTTGCTCATAATGGCCTCCATCCACACTTCGTTGGGCGGGGGCGTGAGTCGCTGACGTTTCTGTGGAAAATGAT
TCACAGGATTCACAGGTCAAGAAAGAAAAGTTAGACGGGGAGGAAGAGGCCCGTAACACGCCGCTCCGCACCTTGTCCCCGTGGTCGCGAGCCGCCCCAT
GGTACATGCTGACCGCTTCCTCGCGCGAGGCGTCGGCTGCTCGTCCAGGCTTCGCGAGATTTGTTGTCACCACACGGTTTTGCCGCGGGTTGTGGACGCG
AAAACGCATACATTCGCGAAGAAATATGGAATACGCTGTCAAGTATGCGTTTTCGGAGGTACCCATCTCAGAAGCTTTCCTGCTCTGGTTTACTGTGCAT
ACAAGCATCATCGCCAGCGCCGCACAAACATTGCAAACCTGGCAGCGTTTCTCC