Description :
From Genome Similarity Track
Location :
Scaffold_4:1261440- 1291454
Transcript NameFunction/comments
Phyin_T30-4PITG_03279Putative uncharacterized protein
Phyin_T30-4PITG_03280Putative uncharacterized protein
Phyin_T30-4PITG_03281Putative uncharacterized protein
Phyin_T30-4PITG_03282Putative uncharacterized protein
Phyin_T30-4PITG_03283Putative uncharacterized protein

Sequence
30014 bases(100 bases per row)
ATGATTTCCACGTTTTCTTACCGGGTGATCCCGCACGTCCGTTGAGTTGCGACGACCTGAGCCTGAAGATCCCCCGACCTTTGACACGCTTCTCGGCTGA
AGCTTCACCGAAGCTCATCCTCAATCAAATGCTTCGCCAAGCTGACTGTAAGAAGCTGCTGTGGGTAGTCTTCTGGCACCTACTCGTGTCGTTGGTGTGT
TGGTGCTGCATCAATCCTGGCTCCACGATAGCTCAAGGCCAAGTCCTTTCGCGGTCAGGATGTGTGTGTCTACCTACAATCTTGACGGGCGCAGACTCGC
CTGTTTCGTGCTACCAGACGAACTCCACCTTCGGGTGTGCAATAGAGCCGTCCGATTCCTGTGCGGGTGGCGTATTGAACCGCGCATGGGACCTCTGTAA
TGGTACGTTTACCTTGTGTTATATGGATTTCCAAGATTTTTGTTGACTGCAAACCTTTAGTCGTTGATGTGTATCTCGTTACCGATCGAAGGTTTTCAAC
TGCGTCAACAGGATCGCTTTATGTAACTTTGTTTGATGAAGAGAAAGTTGTGCTGAAAAAGACAGAACTGTCGAATGAAATTCTCCGGAAGAAGATTTCC
AAGGTGACGCTTCCATTGGATAATCAAGCGGAAGTCAAGACTGTCAAGGTAAATGATACTACAGCAACGATGATATGTTGTAGCTCACTAATTGTTGCTT
GGCGACGCTAAAACAGATTGAAGCTACTGCTAGCATATCCCTTCGGATATTCGAAGTGCAGACCGCAGTGAATGACTTGCCACCTACGATATTTTCACCT
CCTACACCTGGATCGATTTCATTCGTGGGTAATGAAGCCGCAGTAAATTCTGGGATCGTGTCACTGGATTTTGTTCCTGCGACTAAGGTTTTAAATGGTC
AGTAGCTGTCCAAACAATGAGCGACGCTGACTAACTAACGTTATGTTTCTGGTGACAACTAGACGCCGCTAAAGGCCAGTGCGTGTTTAATTCAGTAGGG
CGTTGTGGGTACCATGCCGACCTTCAACGGAGCTCAGACGTGCTTTTTCTAGCGGAAGAGGGGGTTGAATCGATTGTGGCAGCCAAATCGGCCCCCACGT
CATCATCTCGACGTTTATCTGAGCCCGAGAGTCTTTCGCAACCTAAGCCGCTCTCATCTTTAACTGTGAGTGGTGATCTGGGTAGCGAGTATCTTAGTGT
TATCCTGCCACAAGATGCCGTGGTGACGGAGCCTGTGGAGGTCCTAGTCAAGGATTGGCTTGAGGCTTTTAACCAAATCCAACGGGGAAGCGAATTTTCT
GATCCAATGTCAGTCGGAGTAAGGTGGAGCAATCCGTGTGCGTTTGAATACGCGCGGATAAGTGGTGCTTCGTCAAGAGAACAAGTCGAGGGTGGCATAT
TAGTGACACGCTGGAGAATACGCCGTCGTGATGCGTTGCTAGAGATATTTATCAAACCTGACTTTATTGGGGAAAGTGACTTCACGGTTACAGTGGACGT
TATGGTGGACGGAAGTATAAAGACGTACTCAAAGACGTATTTTGTGACCATCCAGAGCGATCCACAGATACAAAATTCGGACCTGAAGAACGAAATCAAA
TTGCTATTATCGAGGGCAGACACTGCCGGTGAAGGAACAGCTGGAATTGGTACACAGAACTCTCGACGGCTGGGAAATCTAGATACGTATAATTCTGACG
TTGTCGTTGTGGAATTACTACCGTTGGTTATCGACCTGCAAGAGGATGACCCCTTTCGTCTATTGGCTTCAGACCTTCTACCCAACATAGCAGGAACCAG
TGCAACGTTTTGTGAGACGAGTGTGACGATCTTTTCGAAATTTAATGCGATTTATTCACTGGAAACACTATCGACAGGTGTCCAAAAGGTAGCGGCCATT
CGCAATCCAGTTATCCGACACCCATGTCACGAAACCTTGTCGATCAAGCTGCTGCCCAATGCTAAGAGCGTCCGCGGTGAGATGCGCGTTGTTATGGCAA
ATGCTGACGACAACGTGTTAGCTGTAGGAATTATTCCGTTCAGCTGGAGTGTGATTCCTCGTATTGATTTATCAATGCCAACCCAAATTCTTCTTGGAGC
TCACAATATCCCAACCGGGGAGGTCCTGGAATTGATTTTGAACTACTCAGGAGATTATTTAAACGCGAGTGTGGAAATAATGATCGCGAATTGTTCTTCT
TTACATGTTCAACCAGTGGGTTCTGCCAATTCAACAAACGAAGAATGTTCTTTTCTCCTGAAAGACGCCAAGTCTAGCGCATCTTTTAGTGGAATAACAA
TCACTGAACGTCAGGATCAAAACTCTCCAGTCGCCGCAGAGGTGACTATATCTCGATTCGTGCAAGGTGTTGACAGCACTTCATGGACAATTAGTGAATC
GACCCTCGTGTCGTATAATCTCCACTTTTGTGAGCTGACGGAGAGGAATGGTGGACCTCTCGTCTTACGTAAAGGGAAGAAAAAGGAGATTGTAATTTCT
TCGCTTGCGTCTATGGTTCTCGGTGACAGGTTGGTCGACTCGCAGCATTTGAAAAGTATCTCATTCGTTCTGGATAATGCCATGTTACCTAAAGTTGGTA
GCTTCTTGGTTGACGATGCCCCTGCTTATCGTGTTGAATTTTATAATTCTACAGCTTCATTCATCACGTTAGATGCTGGAAGTGTCGCTAGAAATTCCTT
CACTCCACATCAGTATGGAACCTTTCTTGTCGACGTAATTGTGGAGTGGGACAGCGTTGGCAACACTGATTCTGGATGTTATTGTGCGGAAAACTATGTG
GTATCGGTGTTACCATCATTTTCCCAGCCTTTGTTTGCTGCTCCGTACTCGTTCAGTCGAAAAGTTCTCCAAGGATCTACAGCTCAAATTACCATACCAA
CGATGGCTACGTCGAATTCTGAAATTGAATACATTTCTCTTGCTGTTGCTGTGAACACGACGGATGATGCTGTTATCATCAAGCGCGATGGTGTCCAGTG
CTTTCCTTCAGCAGACGATCAGCGCTACTTTCTCCTCGTTCAGCGTGATGACGCTATGGATTCTGCTAACCGCGTTGTCCTTTCGATCACCCCGAGCAGT
ATTTTCTCGGGAATTCTGCAGCTCGCTATTAGCGTCTCCTCGATCGGCTTTGTGGAAAATGCGATTCCCTTTTCAGAACTTAATGTCGAGTCCTCAACCA
TTCGTCAAGTAGAAATCGAATGGATACCGGAAAGTGAACCACTGGAAAAACCTGTGACAGCTGGTGAGGCTGTGTACCGAAGTCTCTCAACACAACTTGA
GGGTAATGTCACACTTTCATTCGCATATCAAATGTCATCAGGTACGCTGTAATTGATCTGCTAAAATAAATTAAATTTTAACTTTTATGTTTCGATTTTC
TTGCGCACAGAATTCTCTAGTATCAGGACGGACGTAATTTTGAATACAACAGAGATCCGACAAGTGTGGTCGAGTGAGTCTGTCGCTGCTTCCCCAGGCC
AGTGGAAATATGTCGATGCCTTCATTGGTCTTTCGTACGCTTCAACAGCTGAAATTGTTTTTCGTGGTGTGGTTCCCGTGGATAGCACGCTTTACTTGAA
ATCAATATCGCTTCGAGACTACAAACGAGAGAGTAAAGTGGGAGACATCGAGTTTGTCCGTGCTACAGGCGGTATGATCTACATCGAAGTCAACACAGCA
CCATCTATCTCTGATCCCGTACTACTTCGCGCACATGTGAAGCAGGCGGGCAGTGCCGGACCACCAGCACTACGCTTCGCAGGTACGATCTTAGTTTTAT
TGTATCTGCACTCGGTTTCCTGACGGTTTATTGCTTCATCAAAGGTGACGGACTTCAGTATCGTGGCTGTATGCCTACCACGACAATGTATCCGTGCAAT
GACAGTTCAGGAATATCATTGACAAGTCTAGGTCAGTGCAGAAAGTTGTGTACCGCTGTCGAAACTCAACTTCGATTTACGTCCGAATCGATTGTGCGCA
GTGCGCAAATGGTTTCTCTTTCGATCGACGAAGCGTTCACGATCGAGTTCTGGGTGTATTTGGAACACTTGAGTCTAAGTTCCAGTGATCAGCAGCTCTT
GCTACTTTATGGCTCTCAAGATGGAAGCCTGAGCATTACGTTAAACAGCTATTTGCTCATATCGCGCTGTCAAAACGAGCTTCGTGTACCCCGTGGACTT
CCACTTCAGACGTGGACACATCTAGCAGTGATATTTAGTGCAAGCCATGAGGTGACAGTCTTGATGAACGGAGTTGAAATGGCGACTGGTCGACTTAGCA
AGGAAAACTGCAAAGCTCCTGCATATGCCTACCTTCAACTCGGACGAGGTATGAGCGTGGACACTTCGAGTAGGCACAGTGATTTCTAACATCGCTATAC
TACACGTTTGTTTGCTTCAGATACGATGGATATTCGACCTGAAACCAGTGTCTTGCAAGGCGCAATGGACGAGGTATGACATTTAGACCTGTATTGTTTG
CAGATACACTATTGGATTCTCACGTATCGGTGTTATTTTTTGAAAGATTCGCATCTGGAAAACAGCGCGCGAGCCAGCAGATGTGTTTGCTTTGTACCAG
AAGAATATCGCACACTCTGATCTGATTCTTGTCTTACCTTTCAATGCTGCCCACAAGACCCACTGGTACTCGTCTGGCGTTGAAGGAAACCATGTCGACT
TTATTGTACAGAACGTACGTGCATCAAATTCGCGACAAATTCACAATTTTGGAATGAGTGGAGACGGAAATTGCTTTTACACGCTTTCCGAATTTACTGC
TGGTGAAGGGTCTGGCCCTCACATTTGCGATAAATACTGTGGCGATGGAAGTGGGAGAACATGTGGATCCAACACGACTGATAGTGTGGCGAGTCTGTAT
GGCAAAGGCCCAATTGGTGTCGGTGGTCTCTCGGCAACTACAAAGTACGAAATATCTGTTGAGTTTCTAACTGATGAGGGGGAGGCGTACGATATCACAA
AGCCCCTAACTGCTAGTACGTCCAACGTAACCGTGCCGGGTAAAGTGGATTATGTCAATGCTGCGGAGCTCTCTGATTGGCAACTTGAGATTTACTGGAG
CCCGGTAGATGATGACGGAGGGTCCAAAATCGTTAAGTATGTTGTCTTTGTGAATGGTAATCAAGTAGCTGCTACCACGGATGGAGATACACTATCGCTC
GCACTAAGCATTGCGCAAATTCCGACGGGTTGTAACATAACTGTGCAAGCAGAGAATGCACTTGGTGTGGGGCCTCAGAGCAATCCACTTGCCTTGGTAA
TCGCGTATCGAAATCGTGCCCCACAAGTCCCACAGTGCTCTAGACTGCTATCTCGTTCAGGTGGAAGTGTGGAACTTGTCGTCGATGACATCACACGTTT
GGCTATCAAGGACTTATCATCAGTGCTCATAATCGAGCAACGTGATGACTCTTTTACCTCTTTCACAACGTCATTTTATCGGTTTAATGGATCGGCAGCA
ACGATCTACAAACTCCGTCACAACACTGGCTACGTCTTCCGTCTTGAAGTCATCAGCAAAACTGGTCTGAGGAGTGGCTTCAGTCCCCCTCTTTCAGTTA
GAACGGGAGATAGAACGAGTCCAAGCAAGTCGCTATTGCCATCGGTAGCTGGCGTGACAGGTAAACCAATTGGTTTAAGTTTTCTTAGCTATATCACTAA
ATCTCCACTCTGGCGTGGTCACTGCAGGGGGAGCGGTTAAACTAGAGCTACAAGAACCGCTCGATACTGGTAGCTTATTGGATCTTTTTAATCTACAGAT
TAAGATGCTGGACTAAATGTTGTTTTGGTTGGTGATCAGGTGGCCTTCCCATTGCTCAGTACAACGTTTTTCTTCTGCACGATGGCACATTTCACAAGCT
GACCAGTATAACTGCATCAAAGACAAACGAGAAAACGACGTTTACAGCAACGCGTGACATGAACGGAAATCCGCTGCTCCCCCTTACGACGTACACTTTT
AAAGTGCTTGCATTACAAGCCAATGCTGTCTGCGATACATTGACGGGAGAAGAATTGGAGAGTGACGCTGTAAGCGCGACAACAGGTGCTGCTGCTATCC
CAGCTCCACCTTCACGTCCCGTGCTGTTGCTCGCGTCAAAGTGCTCTGCAATGATCACTATAAAGCCCCCGGACGACTTCGGAGGTGTCACTGTGACTGG
CATGACTATCGGAATCTTCTTGTCTTCAGGGGATTTACATGATAGCCTAGCAGTCACATTGGCTGCTGGTGAGATATCAATACGAAATCTACTGGCCTAT
ACAAGCTATGTTGTCAAAGCTGCCCTGAACACGACCAAGGGTGATTCTGGATTCGGAGAAGCGCTATCATTTACGACAAAAGATCCAGGACCACCCGGTA
AACTAACCATGCTTGAAATCACTGATCTTGGTTCGAGCTCGCTACTTGTGCGATGGAACGGACCACAAGACACCGGAGGGGGTGCAATTTCAGGTAAAAA
AAACTATCTGAATTCTGGATAAACGTAGGGGGGGCCGTAACATTTGTCTTGTTTTGCTTCTAGGGTATTTTCTTTATCAGCGTGCGATAGTGGCAACCGG
AACGCAAAATCTCATTTACAACGGATCCAGTGATGCCAGCAAGACCTCATTTCTCGTGGGAGGCCTCCTCGCTAGGACCAAGTATTTATTTTCTGTTGCT
CCTGTTAATCAGTATGGATTGGCCGGTACGGAGGACGAAAATGTCGTGTATGCAACGACACATGACCACGAGGCGCCTTTTCCTCCGACCGACATCCACG
AAAGCCGAGTGGATGCTGGGTACGTGGAACTGTCGTTTTCTGAGCCATTCTACACTGGCGGTTTCCCGACTAGATCTCTTCAGTACAACGCGCGTCTCCA
ATCGTTGTTATCATGTTTTGATGACACGTCCGGATGCTCTACATGCTCCCATGCTTTGAATTCTGACGGTGATATCGTAGCACTTGATGCTACTTCGAAC
GTGTGTAGAGCAGCAGTTTGCTCGGATAGTGGACATTGCTGCTTAACTGGTGGAGTTAAATGTGGTATTCGAATGCTTGAGGAGAAGAAATGCGTTTCTA
CTGATGGACCTGGAATTTGCCGTATCGAAGGGTTACACTTTACCACAACCTACTTGATAGCCTTGGCTACTGTGAACGATAAAGGGAATAGCTCGTATTC
GAGCGGCATTATGGTCACTACAAGTGGACCCAGACGCCCCAGTGCTCCGCATCTGGAGCTCATCTCTGCTACGGGAGGCTCAATTAGTTTGAAATGGTCA
CTTCCAGAGGTAAGCGTATTTTTTTAATTGATAATGTGACGCTTTTATTGACATGTAATGATTGTGTTTGAATACTGCCAGGATAAGGGCGGTGCCTCCA
TCGTGCGGATGTCTCTGAGTGTAGATGGAGATGAACTCTTTGGCACTGAGTCAGCTCTGAGCTACACTCATTGTGGTGGGCTTCAGCAGAGTACCGATTA
CATGTACACTATTGAGATCGAGAACGCTGCGGGGTTAACAAACCGAACAACGCATTCGTTTATGACGGCAAAAGCGACTCTGCCTGGAACCGTGAAGCTT
TCTGAACCATTCGTGGACATGCAGAGTATCGCAATACCCGTTACGCTGCCTTGTGATGATGGTGGCATTAGTGGTGGACTTTACCTCGCCTATCGCGTCA
TCAAATCTAGTGACACGACTGTAATCGGAGGATCCGCTTCGTGTTGCACAATTATCGTTAATGGCTTGTTAGCTGCAACTGACTATCGACTAGAAGCTCG
AGCCGAGAATTCTGTTCTGCATGGCGACTGGACTGCTATGAGCTTCACAACTTTAAGTGGAATACCCTCCAGCCCAAACACAACTCTGCTGTTTGCGACT
TCATCAACACTCGAGTTAGCACTGGTTCCGCCATCTCAAAGTGGCGGTGGAACGTTCTCAATTGAAGCGGAAGTAACAAATGCAGCAACAAACTCTGTGG
TTTTTCGAAACACGCTGCAATACTCACTGGTGGAACGAAGATATGAATGTCCCGATACGCTAACGGTTAGTGGTCTCACTGCAGATCAAGATGCCTTTAC
TTATATTGTAGCTGTACGGGCTACTGGATTGTACGGATCGAGCTCTTGGGTACGTCAGACGTACGAAGTTGACAATGGAAAAGCTGGCAAAATTGGTTTT
GTGGAATCGCTGTATCGTGGAGCTGAAGGGAGAGATGTCGAAGTGAAAATTGCACGAGTGTACGGGACTACGACACCGGATGAAAATCATTTTCTGATCA
CTGCTAATGGAATTGTGCCCTGGTGGACGTGTTCACCAACATCTAATGGAGCAACTTGCGTTGCTGACGAACAAGGTGACAACAGAGGTATGTACACAGG
ATTAAGCATGCTAACGTTACTTGCATTTTTTCCACTAAATATCTATGATTTTGCTACCAGGATATATTAGTTTTGAGGCTGGCGAGTATTTGAAAACGAT
TATTCTCACGTTTGATGACTTACAATATGAAGCTACAGCCGTGGCATTGAGCCTGACTCTCGTTTCCAGTACGACAAGTAGTCTTAGTAACACACAATGC
GAAGTTCAGATTTATGACAATGGAGACGCTGGTAACTTGAGTTTTGGAAGTTCGCAGATGGCTGTATACGAAAACGAGGCTGTGGTCCAGATAGCAGTTG
GACGAAGTGGTGGAGTCAGTGGAAAAGTGTCAGTGACACTTACGTCAACAATCAGCTCAAGCATTCGAGAAAATCGACTGCAAAAACTTGTTACTTTACG
GGGACTGGAGTTGAAAATGCTATCGTGCCAGTTGATCTAGCATGGCAGCAGTGCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGATAGTAGAAATTTGACGGTGGAAATATTGGACGGAGGG
CATTTGAGTCCCCCCGCACGTCCTCAAATCACTCAAGTGTCATCGACAGGAGGCTGTATTGGAATAGAGCTCAGACTCCCTTCGTACATGGGCGGATGGT
TTATTGGCTCATCCCTGATGTGGGATATCCGTGTGGGTGCTGGGCCCAACTACACAGTCGAGAAAAACGGTTATGTCGTGTCGGCGCTCAGTAGAATCGA
TGCGTGTGGCCTCAATCTCAATACAAGTTATCCAGTTAATGCAGCTCTACGTACGGATAGCGGGACTAGTGAATGGAAGATCATCGACGGGTTAACGAAC
TCACTTTCGGTTCCAACTCAAGTTCTCGACCTGCTCGCGAGCCCCGTTACAAGTGGATTTGCACAGTTATCGTGGAAAGCTCCGCTGGATATAGGCGGAA
TGCCGATCACTATTTACGAAGTTACAGTTTTGAACAGAGCCGCAAACGAGCAACGAACCATTAGTGTACCTGGATCAAATCTTACTGTGGCCTTTAGTTT
CTTATCAGCGTCTACAGAGTACAAGTTTTCTATTCATGCCGTGAATGGCGGTGGTTTAAGTGGACCGGATTCAAGTATCAGTGTCTGGACTGAGGGCGTC
TTGATACCGAAGCAGCCGCCTGCCCCCGAATTGATTTCGGCTACTGGTGGAGCTCTACACTTCCGTGTACTTGCTCCTGTTGACTGTGGCGGTTCCATTT
TGTTGCATTACGCTGTCAACGTCGCTCGTCATATAGGAAGAGATTTAGCGTATCGTCTGTATGAGACGGGAACTGTTCAAAGTACTTCGTACGATAGAAA
CATCGCGAATGTTTCCATCTACGGCTTATTATCAAATTCCGAGTACTTCGTTACAGTGTCCGTGGAGAATAGTCAGGTATTGTAATAGCTTGGTGTACTG
CTATTGAATACGCTATTTAACACACCTTTGTTTTCAGGGTTGGAGCTGGACAAGTGAGGAAAAAATCTACAAGACCTTTGGCCCCACACCAGTTAGTGGC
ATGACAGCGCCCACGGTAGCTCTTGAGGACCCAGGGGAGCTGACATTACAATGGAATACTCCACTAGACTCGGGCGGACTCGGTATCGTGGGGTATAGGA
TACAGTCACGTCACAAGCTCGCAACCGGTTCCTGGTCGTCTCTTAAAATTGTGTATGATGCCCGGACATCATTAGCTCGAACGGCGTTGATCACGAACAT
ACTGGCAAACACCGAGTATGCATTTAGCGTATCTGGTCACAACTTTAGAACGTTATGTCGCCCCGATGAGGACATGACACCAAGCGAAGAATTTCTTATC
ACAACCCAAAGCGGCTCTGTTCCCTCACAACCGAAAAACTTTCGGAGGGTACAAGTGACTGGTGGATCTATTACATTGGCTTGGGACCCTCCACGGTCAT
CAGGGGGCGAAGTGCTGCTGTGGTATATCATTAAAGGAGGCCTTGCAGACAGCCAGCTTGACGCGATGGCAAATGTTAGCGCTACGAAAACTTCGCTCAC
TCTCTATGGCTTCGATGCTTCCACAACGTACCAATTTGCGATTGCAGGAGAAAATTCTCGCGGTTCTGGATTATACTCTCTATCTATTAATGTGACTACG
GGTTTTGTTAGTGCTCCGGGATCTCCGCAATCATTACGTCAAGTTTCAGTTGGTTCGGGTGGAATGATCAAGCTAGCATGGGAGGAGCCAGATGACTCGG
GAGGTGCAAAATTGCAGCAGTACAACGTATTACGCGATGACAATGCGGCTGGCGTGGTCGTAGCTGTCAATGGAACAGCAACATTTCAAGATCAAAACAG
TATCCTTGCTGACAAGAGTTACAGTTATTCGGTATTTGCTTCCAACGATGTTGCCACTAGCACACAGCCAGCAGTGATCATTGCTCACAGCGCCGTCGCG
TCTGTTCCTGGAGCTCCATCCGCCACTGTCGAAACTGGTAGTGGCTTTATTAAGCTGAAGCTGATACCATCCAAGGACACTGGTGGTATTCCTTTTCTTG
TCCTCGATTTAACTGTGATGCGTGGACTAGTGCCGGTTAATTCCTACAATACCACGGAATCGGAGTTCACCGTGACTGGACTTTATGCGGATGTAGAATA
TTCCGTTACTATCCAGACTGTCAACGCGAAGGGGAAAAGTGAGGCTACTACAATAACTACCACAACAATGGCTGCAACAATTCCGGATAAAATGCTACTT
TCGAGACTGGTAAGCGTGACAGGAGGCCGCTTACAGTTTGAAGTTTTGCCTCCTCCAAATTTTGGTGGAAGTGAAGTTCTGGATTACAATTTCTATGTAA
ATGGAACTCTGAGGGATGTGGTGAGGATTTCGAAAACTGAGTACGACCTCGTGGGCTTAACTGCACTTACATTCTACTCAGTCGCTGTAACAGCAACCAA
CGCGGTTGGAGCAGGTGGACAAAGTGACTCGCTGATTGTTTCGACCGACTCGGTTACTGCACCTGGACAAGTTTGGGGCTTAAAGCTGATCTCGAAGACG
TATGAGCGAATTGAAGTGGAGTGGACGATGCCAAACGATACCGGAGGAGACGCAACAGCAGTCCAGTTTGAAGCTGAGATTAACTCAAGCATTAGCGATG
GTAATGTGGTCTCAAGTACAATGAATACTGTGGTACTACCCGGACTTGAGCCCGCCACAATGTACACGGTTCAAGCTCGTGCATTTAATTTGATTGGAAT
GGGCCCATGGTCTACAAGGATCTCTGTGACGACCGATCCGGTATCGCCTGGAGTCATCAATTTTGAAGAAGGCGCAGTCGACATTCGTGAAGATGCTGGA
TCAGTGACGCTTACTCTAATTCGCTCCATGGGTGGCTTCATGCCTGCTACTTGTACATTCTCCACGATAGACGGAACGGCAATAGCTGGTGATCATTACG
TCCAATCGAGTGGTCAAGTCCACTTTATTCGGGGCACAAATCTCCAGCAGATAACTATCCCAATCAAAAACAACGACGTGATCGACGACCCAGATAAATA
TTTCTCAGTCTCAATCGAGGAGTATAATGGCGAATCTGGAGCTATTGGAGACATCTCGGCGGTGAATGTTACCATCACTGACGATGGAGACGCTGGTGTA
GTAGCATTCGAGAAAGAGCACTATATTGTTTCCGAAGCCGTGTCGACACTTTCTGTAACAATCGTAAGGTCAAGACAATTCAGTGGAAACGGAACCTTCG
TGATTATACCAGTATTTTCTGGCGACGGTGCAGTCGAAGGTGTTGACTACAAAATTCCAAACACATCGGTGGCATTTTCCGACCAGGAGACACAAGTGTC
ATGTAACATTACAATTATTAATGATTTAACCTATCAAGAACGAAAGCTGCTCAAATTGAAGCTGGACGTGGTAAGTGGGCGCATCGCTATTGCTGACCCT
GCTGGATTTGCTACCGTCGAGATTTTGGACGACGGAGATACGTCGCCTCCGGGTCTGCCCACTAGTGTTCAAGTTTTTGTGGTTTCTGGTGGAATGGTTA
ACCTTTCGTGGATAGCTCCAGAGTATCTAGGAGCTAAAACCCCTGGAGATTTGTCGTATGTTTTTCGTGTTGTGGAAGTGCAAAGTGGATCAACCCGCGA
ACAGTTGATAAACTCTTTAAGTTTCTTGATTCCTCAGCTGAAATCTAGGAGTGGGTATGAATTCTCGGTAGCAGCAAAAACGGTTTTCTTCCTCGGCGAA
TATTCATCGCCGGTACCAATTTTAATGAAAGAACCAACGCCCCCGTCGAGCCCCATCGGTGCCCAGGTACAATCACAAACGGGAGGGATGGTTACATTGT
CGTGGTTGCCTCCATTTGACTGGGGGGGAGTTGACATCAGCAGCTATCGAGTGAATGTGAGTACCAGTACTGACAACAAACCCGTCGGGTCGTACAACAC
AGTCACAAATACCTTGTCTGTCGGTAAGCTGGACCCAGTCACTAGCTACAGCGCCACAGTTGAAGCCATTAACAAAAACGGATTTATCGGAGAAGCGAGT
CCGGCTGTTACATTTACTACGACCGGTGTCTCTATGCCAGGAAAGCCAACATCTTTGGTAATTACAAAGGCAACTGGAGGTGCATTCCTTGTGGAGATGG
CACCGCCACTGGATTATGGAGGCTCCCCTCTTTTGTATTTCACATTATTCATGACATCCTCGCAATACCCTAGTGTCTTCCGCCAAGTATATCAAGGCGT
TACTCCATCATTTTACGCGACACGACTAGCGTTTTCGACTACATACAAGTTGCAGTACAAGGTGACCACCAAAGTGGTAAGTTTCATGATATTCTTGTAG
ATATTTTAGCAGCAATTAACTTTATTTTATTCTTGTTTGTCGCTAGGGGACCAGTGAATTAAGTGATGTGTTCGTTGCGACCACAACGTTCTTGACATTC
CCGGATGAAGCGCCAAACCTCGTTGCAGTGTCGCGAACTGGAGGATCAGTCACACTTTCCTGGACGCAGCCTGTGGATTTTGGTGGAACAGACATAACAG
CCTACGATGTGGCATTTTTCTTGGGGTATGAAGTCAAATCTCAATTTCGACAAAGAGTATCGGACATCAGTGTGAATACGACATTAGTAACTGCAAAAGT
GGTGGGGCTTCAGGCAAATTCCACGTACGGATTTTCCGTCTCGGGGGTTAATGAGGTGAGTGTCTGCGAAGATCCATCAGCTATCCGCAGTCGTACGATC
CTGCATAGTAGTACGGATGCAGCTGTCTCTTTGCCAGATACTCCACTCGGTTTAGCAGTGGCCGTAGCTACCTCCGGGACTCAAACGATACAATGGACCG
CTAGCGAAGACACGGGAGGAGGCTCCTTTGTTGCGTATATCCTGTATTCGGACACTAGTGCTGTCCTGTATAACGGTACAAGCACTTCGTTTACACGCGG
ATCGCTGATAAGGAATACCGCTTACGGATATAGCGTCTGTGCGTGGAACTCTGCTGGAACAAGTGCTCAGAGTGCGGGTGTATCGGCACGTACAAAAACA
GAAATTGCTGCTTCAAGCCAGCCTCTGAAACTAAGTCAAACAAGTCGTACCGGTGGTTCTATTGGATTAACGTGGCAAATCCCTTTGGACAGTGGCGGAG
ACACAATTTCAGCGTACAAGTTGTTTCGTAACAGCACTTGGAGAGCTGATGTTACAGCCGATGGTGTCACCATGACGTTTCTAGATGACCAGGGGCTAGC
AGCTCTGCAAGATTACGTGTATACTATACGTGCGATGAATTCCATTGGACTCGGTGCTGTGAGTGAAACCCTTGTTGCTAGTACAGCTGGCGCTACCATT
CCAAGCCCACCCACCCGACTGGACGTTGTCACCAAGGGTGGAAAATTCACCGCTACTTGGATACCCGCCGCAAATTCAGGTGGTATGCCGCTGACATCTT
TTCACTTAGTGGTGCGAAATGATACGGATATTGTGCTGGATAGAACTATTCCTATCACGCAATTATCTTATGTTACGTATGGCGTAAGGGCAAACACTAT
GTATACTGTTCTTGTGACTTCTCGGAACGAGATTGGTAAAAGCTCTGTTTCAACTCAAATAGTAAACAACGCAGCTGCCGCCCAGCCTGCAACCCCACAG
GTTCCAGAGCAGTATTTTGAGTTGACTGGATTGACACGCTGGATGATCGTGCTGAAGTTATATTTCCCGATTGATAATGGTGGAGCGCCGCTTAAAGGAT
TAAACTTGTATCAAAATGGATCGAGAATACGTGCAGTGGATTCAACAAGTCAAACGGAACCGGGCGATACAACAATGCGCTCCACGTTGGTTGAAATTGG
CCCTTTACATGCAGGTTATACGTATTATTTCTCCACCTCCGCTGTTTCATCCGTGGAAACAATTGGAGGAAGTGGTCGTAGCAATGAAATGAAAGTGATT
ATGGGTCCTGCAACTCTTCCTTCGGTGCCAAATAATCTTCGAGTAGCACTGCGAACTGCGTTCTCCGTATTTTTTGAGTGGGATAGAGCGGACGATACGG
GAGGAGATGATGTCGTCTACGAGATCTCTTTTAACAATTTAAACACGTCCGAAACGGGTCAAGTGGAGACAAACACTACGACCGTCGAGATCCCGAAGCT
GATTCCAGGAAATAACTATATGTTTCGAGCTCGTGCCAGAAACTCTGCGGGGAGGAGTGAGTGGACACCGGATTTATCAGCTGAAACAGACGTGACACAA
CGCGGCGTCATTACATACAGATTGGCGTCGTCAACTGTCTTTGAGATGTTACTAGCGTGACTGTCCAATTACTACGTGTGAATGGTTCTTCGAGTACAAT
CACCTGTAAATATTCCAATACTTCTGGGTCCGCTGTCTACAGTCGAGACTACACGTTGCCCCCAGAGTCGGAGCGCTCATTCGCGTTTGTTGGAGAGACG
ACAGTAAAGAATTTTGATGTTCAGATCATCAACAATGACATCTATGAACCGATCCCCCGGACGGTTGCTCTAACTCTCACTGACACAACAGCGGATCGTA
GTGACCCTTTCCCGCCTACACCAATAACAATCACAATTGTGGACGATGGAGATGCTGGAATGATCAGCTTTGCATCAACTGAGGTGACAGTTCTGGAGAA
CGCCCGCATCTTAAGTCTTCCATTACAGCGTGAATACGGCAAGAGTACAGCAGTGAGCGTCCAAATCGTTGCATACTCTGGTCTGGTCAGCACATCGCAG
CCTGACATCGGATTTCGCTTACCATCCACTACTGTGGACTTCGTTGATGGCCAAACTTCTTCATCTGCCAGTATTGTCATCAAGGACAACGACGTGTACG
AGTTCCCGTACTTGTACTTCTATCTTACACTCGAAATTGCAACAGGAGCGGCCAAAGTAGGACCAAACAACGTGGTTAAAGTTGAAATATTGGATGATGG
TGATCGCTCTGTGCCAGGAGTGATGAAAGTTCCGACACTTGATAAAGCGACAGGAGGAATGCTGAGATTGAAGTGGGGACCTCCTCTGAATGTTGGCGGA
CAAAATATCTGGATTGCCGCATACAACATTTCTATTCGTGATGCTAAAACTGCAAAATGGATTACTACGCCTACGAATGCTTCGATACTGCCGTTTGGGG
GGCTAAATGTTTTAAGTGAATACGCTTTCACCATTTCAGCAATCAACAGTATTGGACGGGGCGCTGACAGCGCTAGCGTCACGTTTTCGACAACAAATCT
GACCACACCAGGACCACCTGAACACATTTCTTTACTGAATCGCACGGGTGGCTTACTAACCGTCTCGATTGCGGCTCCAAGTGATGCTGGGGGAACCTCT
ATAACCGGATACGTGGTATATCTGGCCGACCAAGATGGCGACTACCAGGTATGAAGTAAATTACGGTATTGTGTATCAAAGTCTCAGTTGTGTTGACACT
CTTTTGCTTGTTCTTAGGTGGCTTTCAATGGCACTGGACACCAATCGTCGATTATACCAGTTAGTGTGAGCAAGCCAAACACTGTATACACTATACGAGC
ACAGGTTTGTTAGCCCTATTCAAATTTTAGATAAGTAGAAGCGCTCATCACATAGTTCATTCATGATATCAGGCAATTAACGTCGTCGGAGTTGGAGATA
TGTCCGAGCCATTCTCGTTTGAGAGTGGACCCTTCTCACGTCCTGGTCCACCCCGACTCCCTGCTTTACAATCTTCTCGAAGAGGTGGTAAAATAACGTT
GGATCTCTTGCCTCCGCTCGACACAGGTGTGTGTATTGTAGTTATTGGGGTAAAATTCTTCCACCATGAAAACTGAGGTGTGGTATGCTTGCAGGTGGTC
ACAAGAATATTTCATACATGATTTACTACCGCAAACAAGGTCTTGGCGATAGATTTCGTCAGGCCTACTATGTAGCAGACGACCTGCAGGTCACGATTTA
CCGCTTGGCGGCGGATAGTACCTACGATATGGTGGCGATATCACACCTTGAAGACTCTCTAAACGCCATCACTTGGGGAAGAATCTCAATCTCCGATTCT
AGGATCACTCTTTCGGACAATGTGACGACTGAGATTATGAAGAGCGGGTACTTCGATTTTGGCGTAAGTCGTTGTGTAGCTATTCGCTCGGTTGCCTTCT
GTCTATTTAACTATCACATTACATTGCTTTGTAGGGGTATTTGTTCGAGGTTGACACAGCTCAAGTCCAATCCAACAACACTTTCGCGTATTCGGCGTCA
TTTAGCACCGATGCCGGGGCAATCGCGACCACAAAGCTGCAAAATGGTGACGAATACGACGTATTCGTGCGTGGAACATTTAGTGAGATGGCGAGCTACA
CTACAGCGGCACCTACCCGACCTGGAAGGCCACCAGAACCTGATCTCGACTATGCGACGGGTGGTGCACTTCATGTGCGTATTTCCTGGCCCGATGATAC
CGGTACGCGGACGCCTTTAATTTTTGCAAAACAATGTACATGTAGCAACTAACGCACTGGCTGGATCAGGTGGGATACCAATTACAGGCTATGAGTTTTA
CATAAACAACACAATGGTATAGTATTTTGTAGAGGAGTATGTAAGGACTGCATCGAGACTAATATTTCTTTGGTTATAGGTGGAAGGAACGTTATACCAC
TACATATCGCAAGGTGAATTCGAGTTAAAAGTAACTGTGGAGATCGGTGGATTGGCCCCCGAAAGCACCTACAATTTCTACTACATCCCACTGAATGATG
CATCTGCGTGTCCTGGAGCCGATGAACAACCTCCTGTGCAAGTCGAATACACGACTGAGAAGGCATCCAAGCCAATGCCAATCCAGCTGATACGATCTAC
TGGGGCCACCGGTGGCGGGATTCACGTGGAGTTAAAACCGCCAAACGACAGAGGGAGTGCCCAGGATCTGACTTACCAGATCTACATGAGCCCAAGTAGA
ACAACGCCAATATGGACGCAAGTGTACGACGACAAAGCCATCAGCTATTGGCAAACGAAGCTGCAGAAGATGACCGAGTATCTGTTTATGGCTTCTTGTA
AAAACGAAGTTGGTTCTTCCAGTAATTCGACAATCTTCTCACTACGAACAACTCTTGTATCTGCACCGGGTCCACCGGGCGACTTGACAAGGATTAATGC
AACGGGTGGTATGGTTCAATTCTCGTGGAAAAGTCCGGAAGATGATGGCGGAAGCCCCATTTCGTATTACTCTGTACACGCACAGGATACGAGTGGAAGC
CCTGAATTGGTACTCGAGTCACTCTTACCGCAAATAAGCTTCGGTGGGCTACTTGCAAGTCGAGTCTATGAATTCAAAGTGTATTCTGGGAACAGTCTAG
GAACCGGGTCCGACGCCAGTGTGAAAAAGTTTTCAACTACCTTACCGTCTTCACCCTCGTTGCCTGGCGATCCGATTGTTCTCCAATCGTCTGGAGGTTC
TGCTACACTCGAAATTAAAGTCCCAAACGACACCGGAGGAGTAAAAGCTGACGACCTAGTGTGCACTGTGTATGGGAATGGATTTAAAGTCCCAGCAGAT
GCTGTGCGTCGGTTGCAAAGTAACCCCATTGCGGCTTCAAAGCGTCGGCGTCTGACGACTAGGGAGCTGGCTGTGGATGATGGAGCGTTTATCTATCTTC
AAGCAGGAGGGCTTCTTCCCTTGACAACATACGCGTTCACTATTCAAGTATCTAATGACGTTGGAGTAAGCGCTATCACGGACGGTATTGGAACTGCAAC
TTCAGTGGCTACGGTGCCAGGTGCCCCAGAGCCACCGACAGTGACAGGAGCTACGGGTGGTGCTATTACTCTAGCTTGGATAGATCCTGTCGACACGGGA
GGAGTTCCCTTAACTTTATATCGACTTAGTATGAAACGATTGGATGTGGAAGTTGGGAGCTGCGAGGGAATGATCCGTTCATGCACTGTTGGAGATCTAC
TATCCATTACGGACTACACAGTGACTCTGGTCACTTACAACCCCGTCGGGATGTCGCCACCGAGCAACGCCGTCACGTTCACTACTGAGACCACCTCACT
CCCACTAGCTCCTCAAGATGTCCATGTGGCCGAGTTGTCGAATACTTCTGTAACAATTCACTGGGATCCTTGTATCGACTTTGGTGGTGGCTATGTGGAT
ACATACCTATTGAATGTCGTACAGATTTCGAGCCCAAGCGCTACATATTCTGGTACAACTTCAGTTGATGAGCACATCCTTACTATCGAAGAGTTGATTC
CCCAGACAGAGTACGCTGCCACGGTGGTAAGTACTGCCCAGAGTTATTGTCTTATGTACCGTGTTAATTGATGATATGGTGTGTTAATAGAGAGCGGTCA
CTGGTGCTGGCGAACCAGGAGAAGCGAGTAAGACGGTCTTCTTTCGGACGCCGCTCTACGCCCATCAACCTTCACCACCACAAGTTGGTTGCCGTAAGAA
CTGGAGTTTTAGTAGAAGTGATCGTTTGTATGCTTTGAGTAACGTGATCTGTATTGGTTACATGTACTTGTAGACTCCCGTAAAGTGGCTAATGTGTTTT
GGGAGACTGAAGATGATGCGGTCAGCTACCTCCTATATCGCGATGGAAAGTTCTACGTTGACAATGGAGAAGATATCACGTACGAAGACGAAATTGTCGT
GGGCACTACGTACATATATCAAGTCCAAGTTATCCGATTCGACGGCTCTATCAGCGTTTTAAGTGAAGCCACAACATTTACCGCCCTGCCCCCAGTAACA
AGTGGTTTCGACTGCGTGGGAAACAAGGGTCACATCCACTGGCACGATTACAAGAACTTGGATCACGAGACATGGACCATCACCCCACACAATCAAGCAG
GTGTTTTGATCAGTGTAAGTCTTGGTTGATGCATTATAGCGGTTCAGAGTTCTAATACTTGTTTTGGTGACCGACACGTAGTTCTCGATATTTTGGCTTG
AATGTGACCACGACAGCTTAACTATTAGCGTGACAAAAGGCGGTGTGACGAAGCAGTTATGGAAGGGAGGATGCCATCGAAAAGGAGACTTTGTTGTGTC
AACTGGGCCTGGTTTGGATAGTGTGACGCTCGAATTTACGTCGGATGGTAGTGTGGCTTACGAAGGGATGGCTCTACACTATGAGGCTGTCGATGCAGCG
GATGCCGTAGAGTCTGTTTCAGCTCCCTGCCCTCTCTCGTCCAACGGGTTTTGCTCACTGAATGGAGCTTGTCGCAAAGGTTCTTGCTCGTGCTTTAGTG
GATTTATTGGAGAAAGCTGTATAAATGCAGTTATCTGTCCTGAAGATCTATCAACATGTACATCGACAACCTGTGACCCGGTTTGCCTCCAGTCCCAGAA
TGACGTAATTGTCGTGAGTGAAAGCGGAGATGATACACAGGGAACTGGTGAGAGGATGGATACTTGTACAACTGGCACAGATCCGAAAGCTGTCAAGTCG
CTGCGACGTGCTCTTGAGCTCGCCACGTCTGGACAAACTATCTTACTCTATCCCGGCGTTTACAGTGGGGCTGATAATTGCGGTGTTACTGTCTCTACCG
CTGGTCTTCTCATTCGAGGACTGAGAGGCCCAATTCCAACAATTATCGATTGCAAGAACCTACTCCGAGGTTTGATAATCACTAGTAGCGCTGAGCCAAA
CCAACTGGAAGGGCTCACTCTGCAGAATACTTTAGCAAGTAACGATGGCGGTGCAATTCGAGCTTCGGATGCGTCTGTTCGGATGAAGAATATGGTCATC
ACGAATGCGAATTCTCACCAGAATGGAGGAGCCATATATGGGTACCAGTCCCAGCTAGTTTTTACTAACGTGGAGATCACAAGCTGCTCTGCTGCTAAAG
GAGGTGCTATTTTCTTGGATGGGTCACGTTTAACGCTTGATCATTCGGTCGTTAAGCTCTGTTCGGCAAGTCAAGGCGGTGGTATATACGCGCAGAATAC
TGTTTCGATAAGCGGTGATAAAGATAGTAAGTTGTGGAAAAACAGTGCCTCATACAATGGGGGTGGACTCTGCGTCGCTGGAATTTTTACAGGCACAGCA
CTGAACCTTCTCGAAAACACAGCGCTAGTGGGGGCTGGCCTAGTAGGCACAAGTGGAAGTTCGACACTCTCGGACGTCAACATCGAAGGCAATCATGCAG
CCAATGATGGTGGAGGGATTGCGCTACTTAATACGGCAAATCTGGTGCTGCACAACTCGCCGATACAGACAAATCATGCCGGTCGCTATGGCGGAGGACT
TTACATGGTATCAAACGGTTCGTTCGAGAATAGCTTGGCTTCAACAATTTTGGGCTGTACTGCTGGTACGTAGATATATTTATTGCGAGTCGGCTTGATA
GCTAACTTTGTTTTTGCGATCAGCTACTGGAGGAGGATTTTATGCCGGTGACTGGGGTTAACTCCGCCTGAAAAACCTTCATGCTGTTTCATCTTCAGCT
ACCGTATCCGGTGGTTGTGCCGCGTTTTCTCGCAGCTCTGCAACGTTAAGCAATCCTGCTTTCGAGAAATGTGATGCGCCGATAGGCGGTGGAGTGTACG
TTGACACGGGAAGTAAATTATCGCTACTGCATGCTTTGATTGCAGACTGTACGGCAACAACTGGTGCCGGAATGTACATCAAATCCAGCTCAGTAGTCGG
ATCTAGTGATGTGGCATCTGTAGTTCGAGACGGTCTAGCCAACTCTGCGGCAGGTGGTGTGTACATTACTGGATCTCCGAGCTCAATCCAATTTTTCGAT
GTGCACGACTGCTCAGCTGCTCGTGGAGGTGGCGTGGCTGTACAAGAAGCTTCATTAGTGACGATAAATTCGGTGAAAATTATTAAATGCAAGGCAACTA
CAAGCGGTGGCGGGCTCTATGCTCAATCCTCTATAATCCAGGTAAAATCTGTGGCTGTCAATAGCAACGGGGCCGTAGTTGGTGGAGGGGTCTTTGCTAT
CGATTCGAGCCTTTCGGGTACTATTACAGTGAGCGCGAATAATGGAGAACAAGGTGGCGGAGTTGCTACATTGGGTATCTCGACACTGGACGGAGCTATC
ATCACTTCAAATACAGCCTCGAAGAGAGGGGGTGGGCTGTCTGTTAAGACTGGTGTTTTATCATTAAAGTCCTCAATAGTTCGGTCTTGCTCCGCTCCTC
AAGGTGTTGGTGGAGGAATTTCGATCATGAATGCCGATGTAAAGCACCACGCATTGAAAATCGAAAGCTGTGAATCTCTCCGAGGTGGAGGAGTTTACTT
AAACGCGTCAACATTCTACCAATATTCGACCGAAGAGAGTGCTGGCATGAGTCAGAATGCTGCATTCTTGGCCCAAAACCGAGCTGACGAATACGGAGGA
AGTATTTTCGTGGATGGAGAAGGAGCGGTCGTCAGTGACTTCGTAGTTACCGACAGCAAATCAACGTTTGGGGGTGGGCTAGCAGCTCAGAATGCGGATT
CTTGCGTTGTACTGAATGCGGATATTTCGTCGTCGACAGCATCAACTTCGGGTGGTGGGTTGTTCTTTGGATCTGGCGCTAACTGCGTGTTTCGGGACTC
CTGGGTAACTAAGAACCAAGCTGGCGAATCAGGTGGTGGGCTTATGCTCTTTGAGGCGACTGTGTATCACTCGAACGTGGAAATCTCCGAAAACGTCGCC
CCAACTGCAGGTGGCGTATGTTTGAATAGCGTGCTTCAGCCTGCAAATTTTTTATCTTGGGGTGATGCTGCGAGCCAAAGATCACGTATTGACGCGAATA
TTATCGATCCGAAGGGTGGAAACGGGGAAAATGTCTTGATGAATTGTACCAGCAACTGTACTCTGTCAGGGTCAGTAATTTCTGGCGCAAATTTACAGTT
CGGACAAGGGGCTGGTGTCTTTGTTATGGGTCGTGGTAATGCCACAATTTCAAACTCTCTTGTTGCTAATAACTCGGCCGTAAAAGGTGGAGGCATCGCT
GTTAGTGACGCGGCCAAGACGGTAATTGAAAATGTTGGGTTTATCGGGAATATTGCAAGCGATCGTGGCGGTGGGTTATGGGCGGAAAGCTCAACTTTGT
TACCCGAAGTCGGCCTCCTGAGCTGCGTATTTTACAACAACTCGGCAAGAACCAGTGGTGGGGCTATTTCGCTCTATGGAGTGAATTTGCACAGTTCAGT
TTTACTGGTGGTGAAGAATAACGCGGGAAATGCTGAGTCGGGTATCGGTGGCGGACTCTACTGTGATAAACGTGTCAACCCAGAGGCACCTTCCACTGTC
ACAGCAGACAGGTGCCTGTTCTTGTCAAACAATGCACCGGTCGGAGGCTCCATCGCTGGAGTCAAATCCTCCCAGATCAGCCTACTTGACACAAATATCA
CGCGCGACGCTGATAGATTCTTCACGGAAACGTGGCCAGATCTTTTCGAAAACCTTGTCGGCTTCAAATACGCTGAAGACCGAGCCCCAAGAAAGATCGA
CGCTCAAAAGGGAGATCTCATCTATCTTTCGGACAGAGATTCGGTTTTAAAGCTGCTTTCATCGTACGCAACACGCGGATCGGCAGACGCTGGAGGAGGG
GTGTACATCAACGCTAACGCGTTTTTCTACACTGAAGACTCCGAAATCAGCTCCAACTCAGCAAACGAACGTGGAGGAAGCTTGTGCTTATCGAACAGCG
CCCAAGCCTCTTTCGTTTCCGTCAAAGTCGTATCCAGTGGTAAGTCTGCTCGAATAGCTTGTGTGAAATTCTTTTATTAACAGAGTATTTTTTTAGATTG
TAAAACGTCTGGGGGCGGGATTTATGTCGAATCCTCATCAAAACTATATGCGTTAGGCTCAGAAATATCGGACAACTTTGCAGATGACTCTGGAGGCGGA
ATCTTCATTGACACGGGCGACAAAAACGCTGTCACTCTGAATGGCACTTCCATACAACGCAACTTCGCTCATGGAGAAGGATGCGGTACGAGGCCATTTG
CTCACGACACAAACAACGTTGACTAATTACTGTGTATATCGGGCATCTCCAGGTGTTTTGGTTGGACGAGAGGCGGTTTTTGCTGGCTACAAGTCTCAGT
TCGTGGGAAATGGTGGGGTGACAACCAGCGGGAAAAACGAAGGAGGCGGTGCAATTTCTTCGATTGATGGCATCGTGAAGCTCACAAGCTGTACCTTCGT
AAACAACACTGCATTAGTTGGTGGTGCAATTCACTTGGATCGTGGTGGTTCGGCAGCGATCATGAGCTCGGTGTTCACTGGGAATACTGCAGATCAAAAC
GGAGGGGCGATTGCAACAACCGTCAAAGTAAAAGTCACGATTGCGCTGCAAACCTCATTTGAGAACAATGCGGCTCATTTCGGAGGAGCCATGGCAGTGT
CCGGGACATCCACTATTGTACTGACGTCAGTGAACTTTCGTACTAACCGAGCCAGCGAGAATGGTGGGGCTCTCTTTATGACGGACCAAGCAATTGTTAC
TTTAAAAGCTGGGGAATTTGATGGTAACAGCGCCGTATTTGGTGGTGCCCTTTATTCTCAAGATCAGTCTTCGACCAACATCGTGGACACGAAACTTATC
AAGAATGCGGCGTTTACTAGAGGAGGTGCGATGTATTATCAGTCGATTGATAACGCCACAATTACTGGAATCATTTGTAAAGAGAACACTGCACCCAGTG
GAGGGTGCATCTTCTGGGTATCGGATGATGAAGATCTCTCGCCTATTTATCCATGTACATCCTGCACGATGGTATCCAACAAAGTGTACGATATTGCAAC
CAATACGCGCGATGTCCATGTGATGTGGTGGCCTGAAAACATGACCAGCGGCGTGCCTATACTGGAGCCACCTGATGAGGAATCGATTGAAGTGATTAAA
ACACGTAACGAAAGCCTAGAGAAGACAGTGCATGTGTGGCCTCGACTCAAGGCTGTGGATCTTTACGGGCAAGTTGAAGTGCTCGATAATCAGACCGAGT
GCATGGTGAGTGACGGTCTGTGCAGTGAGCAAACCGAGCGATTATTATTTGAGCCACGAGCTCTGGTGCGCTCTTCTGTTGGCGTTATCTCCTACCGTGG
GGCCAGCTTCACAGCAGCCAACAGAACCCCCGAAGAAGGAGTTTACACTACAGATATCTCGTGCACATTACCAAGTTCCGAACCGCGGTATTTCGAGCAA
AGTGTAAAGCTGCTGCAGTGTCAGCCAGGGTATTCAGTCAACCAGGGGTGAGCTCTAGTTCTCTGTTCGACTGGTAATGCGCTTGTGACACTGATATTTA
TGTGTTTCCAGGGTTTGTGAACGCTGTTCGAAGAATATGTACAGGTATTACCTCGCGTCTTCAAAGTGGTTCAGCTAAAACCTTTCGACTAAATATTTTT
GTTTTCATTGCTGCAGTTTGGATGGAAAAAAGTGTTTCGACTGCCCTTCTGGTGCCAAGTGTAATATGAATGTGCGCCGAGCGATCGATACAATTGCAGA
GGAACTCGGAACGATATCCCCACGTACGGAGGAAGGGTACTACCTCTTTTCAGCCCCCGCAACAAAGCGAGAGTCTAGTTGCAATAAACCATCCCTGTGG
AAGGACGAAGATCCGTGCAAAAAGATTGCGTTAGGCAACCCAAGCAAGAACCTCTCAGATGTGATCTACGAGTGCTCAAATCTGAATGACTTCAACGTGT
ATTGGTCAGCAGATCGCCTATTCTCCTGTTTGTCGGGAAAAACCTTCTACACCTGTGCTGTAAGCTTTCGAGGCTTATATATTGAGGGGTACGCATTGGT
TTCTGACAGTTGCTATCTTGCCTACAGGTTGAAGGCGCATGTCAAGCTGATGTTTCGGTTCAAATGCTCGCACACACAGCAGCAGTGAGCACTGTATCGT
GTACCACTGGATACGACCTGGCAATTTGTTCCGTGTGTGCTGATGGATACAAGCGTGCCAGGGATAATTAAGTGTTTGCGTAAGTCTCTCATTGCACTGA
AGTCTAGCAAAGTGTTACTCCTGGTCTAAGATCTTTTGCTTTATGCTGCACAGCATGCAATGAGGCAAATGCTGAAGTCCGAGCTTCGATCAAGTGGCAG
AATTTTGTCATTCCTGTGCTGCTGGTCCTTGCGCTTATCGGAGGAGTATTTGGTGTGCGATTCTATCTGCGTGACCTCACAGAAATCGGCCTTCTTGCAA
AAGCTGAAGCTGATAGGCGGCTAAAAGCTCCCGATTCAAAGAAAGGTCACATCGCTATACGTGCGGGGGCGAAATATCGGAGACAATCTATGGCAGTGGT
AGGCCGAGTGGATCAAGTGAAGAACAAACTTACTACCTTCTTCAAGAAATACCAGAAACGAAACGCGAAAATGGTTTTCGGAGTGGATGTGAGTCCTCCA
CCACGGACGTTCCCAGTCAACCCCAGCAAGTTCAAGATTTTTATTGGGTTCTTTCAGATATTCGGCAACTTCCAGAGCTCTTTCGTCGTGAAATGGTCAT
CCAATGTTCAAGACGTTATGAATGTTTCTCAGAAGTTCAATCTGGTACGGAACGGTTGGTCAATTGGCTGTGTTTGACTTGACTATAACATGCGTGAACT
TTATGACTAGGATCTGGTGGCAATTGCTGGAATTGATTGTGTGGTAACGAAAAACTTCTACTTCGACTTCACGTGAGTTTTGTTAATTATACAGTGATAA
CTAGCTCGCCGTTAACTGACAAGTGTTTGTGTTACGTGTTTTTTTTTACTTACGCCAGAGTGACGGTGAGCCTGGTTGTACTTGCCCTTACTGTCATCAC
GGCGTATTTTTATGCTGGAACGCGCAATTATCGCTCAAAACTGCAGCTAATTCCTCGTAACTGCCTTCGCTGCGGGCTTCCAGTTCTGGAAAGTGAGTTG
ATTCAAAACGACGACGAGAGTTTCAACCCTCTTCGCCTACTTCGCAGCTGGTGGCGGACGTATAATTTCTATAACCGTTCGAGCTCTTCAATTCCAGTGG
AAGCAGCAAAAGGTGGTCTAGAAAATGAAAACACGGCTGCCCTCTCAACTATCAGAGAGACACGAGCGCTGAAGCGAAAATTCGGAATGTCCCAAGTCCG
AACGCCGTATTTGGGTTTGTTTCGATCAGTGCATACCAAGTGCCCGACTAAACGACACGTGCTCTCGGGTGCGTTGCTTGATCGCACAATTCGTGGTAAT
CTTCGTGTCTGGCAAGCTCGAGTGAAGCTACGCATGAATTATCTCACGTATCGAAACAAATGTCTGAAGCTGTACTGCTGGATGGCCCTCTTCCTCTACC
CGTCTGTTTCGAAGACTATACTGACAGTCTACAACTGCCAGGAGGTTGGCGACGTATTTTACCTCGTGGTAGATCGACGTTTGATCTGCTACAATGGTCA
ATGGGCGGTGTTTGGTATGATCGCGACGATCGGAGTCATCGTGTGGGTCGTGGGAATTCCATTCTTTTTCGGGCTTTTGATCTGGCTAGCCCAGGACCGT
GGCGTTGCTGCACGTATCAAGTTACTACGGAAGCCTCAGATGCGCGTACAACGGCAGAAGTGGCTAAAGGAAGTGGACGAACAACATATTGAAGATGGAA
GGTTTGTTCGGGATATGGACAACGTTGAGGTGCAGGACGAGGAGCTGGCGAAGTACATGAAGCGCAAGAACTTAACAGTACGCCATCATAACCCCGAATA
TCTTATATTTTAAGCTCACAATTTCTGTTGTTGAAGGACTCGACAGTGCAAGCTAGACTGGGTTTCATCTACGCCGAATGTGAGTACAGTAGCTACCAAA
TTAAAACTTGAAGCGAGCACACACTAATGCTTGTGCTGTTATTTTTTAATGCAGATACACACGACTACTGGTGGTTTGAAGTCGTGGATCTTTCCCGAAA
GCTTTTCCTCAGTGGTGTAATTGTGTTCGTGGAAAACGGAAGTGTGGAACAAGTTTTACTGGCGCTAGCTGTCTGGTACGTTTGGTTTGAAGGGATTGTG
GGCTGGTTTAAAGTACTTACGCGTTCCTGTATGCTACAGTTTGACGACAATGTGGTTCTTGCTTTACTTCCAGCCGTACGACGGCTACTCTGATAATCTC
ATCGCGAGTATCACGCAGTTGCAACTCTTCTTCACGTTGTGGCTCGGAGTTATGATTCGGCTGAACGATCTGAACATCGAGTCCTTGATCAACGTACAGT
TGCTAAGCTTCCTGCTGGTAGGAACGTGCATTGCTGTCACAATGTTTGGGATCAGTATGATTATTGGGGAAGGGCTAGCAGAGTCACGACGAATATTCAC
CGAGACGACTGCACAGCGTAAGAAACATGTTCAAGAAGAAGTGCGGAAGCGGTGGTTCCAAGCCTTCAATTACGCTGCCTATGAAGCTCAAATGCTGCGT
TACGGTGGTCAACTGAGCTTAAATAACTTAAGCGTACCCGCTATACTGGAAGCCTTTCGGCGGGCTAAGCTCATGGAAGGAGAATCTGAAGATGCCAGCA
TCACGTTTAAAATCGACGAGGAAGCTGCGGATCAGTCAATTAGTGAACGCCATCCTGAGTTTACTTCATCAAAGGTCAACCCAGATGACGATCCAGATCT
CAAGTGCGACTAAATCAGCAGAGTTCACTGCTTTTGTTTTTCTGGGTTGAAGGCTCGTGAATATACGTGCATACTTATACTGTAGGCATGCTCTGTTTCG
ATTCTTCGACGACTCAGCATTGTGTTACTTCAGCTTTTTTGAAGCAGCAACGAACCAGCCTCTACATGTAGTGCGCAAACTTGTCACGACTTCATTCAGC
GCCGTGAGTTTGGCTGATTAGACGATGGTATGCCGTAATTGCACACCTGGCACTCCTGTGTCCTCCAGTGATACGCCCCGTTGACCACGTCAAAGCCTAC
CGCAAACTCAGCACAATATCGATCGTAGAGCGCTTCCCACTCGCCGAACGTCACGATCTCGTACTGACGAGCTGGCGTGGAACCAAGACTACACGTCCAA
CAAAGAAAGATCAGTAAGTTCGAAAAGTATTAACTATACCCAGCCAGCAGGTACAACTTACGCTTGCGTAGCCTTGAGTGACTGCTCCAGAGAAAACCCC
GACAAGAACATGGAGATGTAGGGCGGCACAATGGTCTTCTGGTGCGACAAGCATACAAGCTCAGCATTCAGCACTGGCCCTGGGGCGTCATCTCCCTGAC
TGCGAACAAATTTCCGCCATTTGTTCAGCCACTTCTTGGGTACCAGGAAGTACGTCGCGTACTTGCTTCTTCCACCCACGGACCAATGCGGTGCCAATTG
CTGTCTCCTTCCTCCTGTCTCCACTGGTGAGAATAGTCCTTTCGGGAACCCGTTCTTCCTCTGTAGTAGCTCCAGCATGTCCTCAGACCCAGCAATTTCC
GTGTCAAACCTCGCTCTCTTCTTCTCCTCGGCCTCCAGCTCCCTCGCCTCTTGCTCTAGTACACAAGTGTTGCAGTCACAACACGACCTCAAGCTGAAAC
CTTTAAGCTCCGGCGCGTAGACCGAAATCTCCCTGAACACGTCACCGCTGATAATAGCGCGTCGACTGCGACCCACGCACTGAGCAGCGGGAAGCAGCGC
GTTGTGGGCGCACACGATCATGGCCCCAGCCTCGGTGAGAGATGAATTAGTCGCAAGCTTTAGCTTTTCGGAGACGATATTTTCCCTCTTTTTAGCGGCA
TTTTGCCGTCTCTGTTGTCTTTTAGTTCGGCGGAATTGCTGTAAGAATTGCTCGAAGGCTTGGCAGCGCTTTTTGAAGGCGCCAAGCCACGCGCGGCTCA
CGACAACGCAGCTGGGAGAGCATGAGGCCACGTCTTCGAAGGACCAGGAAGACGAGTGCGCCAGAAGCTCCTTGATGTGCAGCACTTCGACTCCACGTAG
TACAGCGAGAGACCGAGGCCAATGGGATGATGAGGCATCTAGAAAGCTCGAGACGGACCCAAAGCGACGAGTGATGACACGCTCTAGGGCCAACTGGACG
CATGGAGTTGACGGAGATAGGGACCGACACGTAGAGGTTACCTGGAGCACGTCTCGGGCGGACAGCAACGAGAAGAGGTGCGCCAACAGGCCCTCCGGCA
GGTCATCCATTTTG