Description :
From Genome Similarity Track
Location :
contig_120:1261- 4312
Transcript NameFunction/comments
g13403.t1hypothetical protein

Sequence
3051 bases(100 bases per row)
TCCAGTCGCCACGTGTCAGAGTACACAGTGCAGCTCCTATGCGCTATGGGATGTGAGCCCCAAGTGTTTCCGTCGGAAGCAGACCTCCGAGCATGGGCAC
CCGAGGACGCCGCTACGGCGCTCCGAAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTCAGCCGTCCACCGAACGTCCACCA
CGCGTCGGATCCAATCGACCCGTCCATGATTCTGTTACCATTGGCCCCTGGGAGACGCCCCAGAGAGTCGACCGAGGCCGGAATATTTTCGGCCAAAGGT
GCGACCTCGACGTACTTCCAAGACTCCCACATGGTAACGCCTAGGTCGATCAGTCGTACGGAACGACTGGCGAGAGAGGCCGAGGGATACCGAAGCGCTC
CAACTGCTGGACAAAGCGCAAGTCGGACGCCTAGCTGACGTTACGACCCCCGCGATGACTCATTTGACGAAGATTCGTTCGACGTCGGAGACACCGGGGG
TGACCTGACGGGAGAATGGGCGCGCCAAATTCGTGAATTGAGCGCTGTGGAGAATGACAGTGCGACACCGAGGCTAGAGATCGCGACGCATCTCCCACTC
GGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCAAGAAGTCCATGCAGTGGCTCCGAGCTTTCATATACGAGATGAAAGGGACGCACACGCCGC
CCAACGAATGGTGCATAGCGTTTGAATTGAGCCTCCAACATGGTGCTCTGCACTGGTACCGACAGCTGCCCCGCAAAACGAGGCGCACGTGGAAATTGTT
GAGCGATGCGTTCATCAAGTACTACTGTTCACGGTTCAACCAGTCTGCGAAGGTTCGGTACTATTCGGCCAAGCGAGAGCAGAAGGAGCACGTCTGCGAC
TACCTCAACCGACTCAACGGCTATGCTCGCAACGCCGGAGTGCAGTTTGAGCATGGCGGTCGTGATGCAAAAGACCATGTCGAGCACTTCTTGGATTCAT
GCGAAGACCGAGGTCTGGAAGAGCGTCTGTGCCATGTCCGAGTCAAGAACATCCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGGGAGCG
AAAATCGGGACGCGAGTCCTCGGTCCGCTGTCCTCGAGGACAAGAAGTGGTACGCCGACGCTCCAAGGATTCACGGGACGGCTATCGCCGCGACAGGCGT
CACCGAGAGGACGACCGCCGTCGGGAAGACCTTTTCCGAGACGAGAGCCGTCGGGATGACCAGCAGTACCGACCGAGGGTCACTCTCACTGAAGCACTGA
CCGACATGTGACTGCGCTGAATGTGGGACGCCCAGCGGACTCGCGAGGAGGATACCCAGAAGTATACAACGGTGGATATGATGACGCCGAGGAGTACGGA
CCGGAATCTCACTCTGGCGATAACGACCGATATTCCGAAGGGTACTCGGACGACGGATATGCGTCGACCGAGGATCAAGGCCACGTGGCCGCTGCAAACG
CCACTGAACGTCGTAATGCGGCTGAGGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAGGTAACGGTCAATGCCCGTATGACCGAGACGACCG
GCGCCTCAACTCAACCGGACGCGATGGTCGATGCCAATATGGTCCATGCGCCGCCTGTGGAGGACTCACCCATTCACCTGACTACTTCTTTGAGCGATGC
AAGATGTGCAAGCAAGTTCACGATGTCGGAAAGTATGAAGCCTTCCAAGAACTCACGAATCTCTTCCGAGCTAAGTTCGAGAAGAAGGACCTCTCGCCGG
AATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCG
CTGGACGCGTACTATCTGTTCGCATTCGCAGGTGTGTGCAAACGGCCTAATGACGTGAATATGGAATATGTGAAAATGGTGGAAAATGTAAAGGAGAGAG
GCGTAAGCCTCGGTGGGAGTGAAGTGAATTGGCGACGTACGGAAGGAGACGAAGTGGAGTTAACCGAAGCTTCGATCCTCAGCATGGCCAAAATCGACCA
TCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATAGGGTGGTGGTCATCCCAGCGGTACGACAAGAGGAAGCGATTGCGTGTC
TTTGTCAAGGGGCTGTGAAAGACTCGCGAACGAGGATTCTGCTGGACACGGGAGCGAATGTCAGCGTAATTTCCGCGTCATATGCGAAACGGTTACGCTT
GTGCGAAGTTCCGGACCACGGTAGGAGTCTGGAAGTGCGGGGAATTAACCCAGGGGTGATGGAAACTCGCAGGCGAGCACTCGTCAAAGTCACCCTGGGC
TGGGAACGCGTGTACGAATTTGAAGTATGGATTATGGATCACAGTGCAGGAGTTGATGTGGTCTTGGGAACAGATTTCATGATTCCAGCCGGGGTCCGGC
TGGATCTGTTCCACGGCACTGCGAGACTACCAGACGAGGTAATGGTGCCCTTGGTGAAGTCGCAGAATCCGGCAGAGGCCGAGCCGTACAGCATGCGAGT
GACTGGACGCCCGACCGAGGACTTGTCGGTCCCTGGGCGTGAGTGGAGAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACTCATGACGTGTGG
GCCCGCCGGATTGGGAACTTGGTGCCCACTGTAACGAGGTCTCGACGGGGGCAGCCGACGGTGGTGCGACTAACGAACGTGTCACCGAGGATTGCTCACT
GCGCGAGACACGAATCGGTATTGCTGTGGGTGAAAAAGGGTGACCTGCCACAAGGAGATGGATACACTCGTTTGAACTCCGCTAAGTACGAGGAGTGGCA
AGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGACCAGCCACCTGCGGTAGAACGA
CGAGACTATCCGACACCTCGCGGCATCCTACCTCGACCATCCGACGACTTG