Description :
From Genome Similarity Track
Location :
Scaffold_2490:1261- 2851
Transcript NameFunction/comments
Phypl_g15133hypothetical protein PHYSODRAFT_347717

Sequence
1590 bases(100 bases per row)
GCTTACGCGCCATGCACGGCGGTGTAGTTGTAGTACACCAGGTTCTCGTACTCGCTGTCGCAGTACGGGAACTCCGCGTCCGAGTCCGTCGGCGCgaaca
gcgtcttgccgGACGTGTACGTCACGTAGCAGCCCAGGAAGCCGCACACGATCAAGACGATCAGCGCCGGGATCTTCTCGTACAGAGGGATCTCGCGcca
gagcttcttgagcaggaAGATAATGGGCAGCAGGATACTGATCAGCGTGATGCACGAGGCGCCCACGAAGTCCACCAGGTCGGAGAAGTGGTCCTTGAGG
ATAATCGAGAGgatgaccagcaccacgatgATGACGATACGGAGGATCACGTACTTGATCGCGTTCACTCCTCGGTACTCggcagcctccgcctcgagGT
CGCCGTAGTACGGgttctcggcgtcggcgttcGAGATGTACGACCTCTTGGACGAGCGACGGTCGTCACCGTTGACGGCGTCCTTGCTGGGCGTGTTCGC
AGCAGCGTATGAAGCGGCCGCGTACGTGAGGGcgttctccacgtcgtcctccttcttctggtgCATCTTGAGCACCAGGCGCtcggcgaggaagaaggcc
gGGTTCAGGATGACCGAGAAGGCGATCGTGATGTGCAACTGCATGAAGAAGTAggccatgacgacggcgccccAGTCCGACTTGAAGCCCAGCGTGGTGA
GGCCGCTCGTCGAGTCCGGGTAGATGGAGTAGAGCAGGTTGCCCGTGATCTGGCAGCCCACGGCCGAGtacgccgtgctggccaggACCAGGAACAGGCA
CGAGATAAAGGCCATGGTGACGAACACCACGCGGGGCATGCGCGTCGGCTCgctgtgctggcgctgcagggccgGGATCACAATGCCGGCGTTGTAGGCC
AGCGACAGGTTGCCGAACATGCCCGCGACCTGCGAGAACTTGATATCGGGCGACGGCACGGACGGGTGGCCGCGCATGCCGTACATgacgacggccacgc
cgATGACGTCGGCGATGAGCGTGCCCGCGCAGCCGGCAAAGGccgcgccggcgccttccTTGAGCGTCGGGATGAGGCACACGGGCAGACACAGGAGCGC
CATGAAGCAGATCCAGTAGCTGGTGCTGAAGGCGTCCGGGAAGAGGCCGTCCAGCAGggtgccgcccagcacgaggaacacgCAGGGCACGAGCAGGCAC
GAGGCCATCTGCGAGATGACGGCGAGCCAGCGGCCCCACTTGCCCATGCACCACTCGCCCAGGTCGCTGTAGGTCTGGATGCTCTtgggcgccagcagca
tcacgcgGCAGATGGCCACGGACGCGTACACGTTGGCGAAGGCCATGAAGGCCATGCcgacgacggccagcacggGTCCAGCGCGCGAGAAGTTGCCGGG
CATGCCGAGCGTTCCGATGCCGtagacgcagcagaagatgtTGAGCGCCATCTTGAGGTCCTCCATGGTGAGGAACTTCTTGACGCAGGCCATGGTTGCG
AGAGTGGCAAGTCGGCGGACGCGAGCACGGGGGTTTGCGAGCGAGGGGAGTGCGCGCCACGAGGCAAAAGTGGGAATGAGGCGAGCTGCA