Description :
From Genome Similarity Track
Location :
Scaffold_6:1260994- 1262695
Sequence
1701 bases(100 bases per row)
GCTGAACGTTTCGTTGGATTGTCGAGCGAGTCATGGACTATAAGCCTCGAAGACGAACCGAGATCAGGCTCGTCTTCGTATTCGTTGGAGAGGATTGCCT
CCCCATCAAGATACATGGGAGCCACGGGACGTCCTGATGAAGGACGTTCCGGAAATAGTGAGGGCGTACGAGGCCCAGAATCGAGTGCATGCATAATGCC
TGCACTAAAACTGCGAGAGCCACCAACACAGGATGCATCCCTGTGCTCAAGTTGAGCACGAAGGTGTCGCAGAGGAGCGGGTACACGTACGGAAGTGTAC
CCGAGAACATCGCGTTCAGAAAGGCGCACTGCCCCGAGGCGGAAGTGCGAACGCGCAGTTTCAGATGGAACTGCGCAGGGGATTCCCGCTTCCATAGCGT
CAATATGGAGGCGATCAATGAGATGACGTCTCGAGAAGGTATTGAAGCGCTGGCGAGCCGTGACAAAACGCTCGCGGTAGCCTTTCGCATTGTTGTTGAA
GCTCACAACAAATGCGTTCCAAGAGGCTCTTTGCTTTTGCGCAAAGTTTTCTTCGACGCATTCTATCGAAGCTCATGGAAGAGTCCGATGTACAGTGTAG
TAGTCGCGCCTTTGGTCCGTCAACGCATCAAACTGTCGACGGCCTCAGCGTCTTCATTGATGGCGCTGCACACGTACAATCCTATCAGGTTCGGAGGCGA
TGTCGCGTCGAACCTGTCAGCGATTTCGGATGAAGTTGGCATTCAGGGAGCGCGTATTGCAGGCTCAGTACGCGGAGAAGAAGGCGGCACCGGCACAGGT
GGCTGCGCTTCATCTTCATTACGCGGACGCTTCGATCCAGGAGCGTCCGGAACATCGTCACGGCAACGTCGCGACCCAACAGAGGGATCGGGCGTTGGTT
CGGTCGACTTAGAGTAGAGATGAAGACGATGTCTCCTCGTTTTTTATAGGGACATCTTCACTGTCAGACCCATAGTCAATGAGTATATCTCCGTCAGTAT
ACAGAACTGACGAGCTCTATGACGACTGACGATTTGTCAGTCGTAGCTTGTGCGCACTTCTGCTTATGCATAGTGTGATATAGAGTGACAGAAAGATTAG
CTTCTATCGCGGGCGTGTTCGCTTGCGCGGACACTGAAGTGGTGGTGCCTGCAGGTGCAGGCACGGCCGTAACAGAGTCTGCCGGAGCAGACTCTTGCGC
GGGCATCTTCCTTGGCGAGTTCATTGCGGAATGAGCTCGGGTTTCCAAAACGTTTTGACGGTCTCGTCAATGTTTTGAATGATGTGTTAAGACTAAAAAT
CTTAGCTTAACGGGGAGAGGGGGGGGTGTAACGGGGTTACACGCAAGTGGCTACATGTAGCCACTTGGCTACGAACCATGTTTTCCACGTTGGTGTGAGA
TACACCAATGGTTACATTTGGCAAACTATTGGTTGAAAGTCGATATCTTCAACCAATTAGAATCGTAGAATTCTGTCAACCATTCGTTGCCAAAAAAATC
CCACTCATTTAGAATAGTAGATTAGGAGGACAACACAAACAAAAAAATAAACAGCTCTCAATTTTACCGGAAGTCGGCTTTGCTCTCCTTTTTAAGTAAA
TCTCTGATTCGGACGAAAATATAGTTAATATAAGTGAAACGCAACTTACGTTTCCTCATACACGTACGCCGAAGTAGTGGGCACAGAGTAGGCCCATTAC
A