Description :
From Genome Similarity Track
Location :
Scaffold_7:1260844- 1266475
Sequence
5631 bases(100 bases per row)
ACCTTATATATACTCAGTTTACATTCTACCTTAAATAGGTCACTTCGCTTCGATAAAAGGGGACCTGTGAGCTGCCGTTCGCTGAGAGTTTGTATACTCT
CGGAAGCTAACTTCCTCTAGCGCAAGGTGCTCTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACGCGGGTAGACTACCTAAACCTC
TCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCACCTTCGGGATGGAGGCC
CTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTTGACGCGTACGAGCAGGGGCCCATCGCGCATGTGCGGGAGAGCC
TGCAGGCTCCAGCGGCGGAAGCCAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTGAAGCCGAATGAAGAGGAGGAAGGCGAGAACCTTCACTTCTG
GGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCGGATCTCGACCGAGCAACTTAGTGTTGCTTTTGCACTCTCCAGCCTTAGCAAACGTGCTAAGAGT
TGGGTGTACACACGGGAGGCACATCGCCTGGATGTTTCACAGCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCAAACTACGAGTA
CCGCCAGCGTTCGCGCTTCCTCTCGTGCAAACAAGGGATACGTGAACTGCACGAGTACGTGCAAGAGATACGGGAACTCACGGCGTCTCTAGTGGGAAAC
TCACTCAACGAGCACATTAAGATGACTGTGTTCGTGGACGGTCTTTCGCGTGGGCTCGCACGCACTTCAGCTGCTCTGGGTGCAGCTAAAACACCCTTGA
AGAGGCTATTCAGAAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGAAGTTCCTTGTCGACTCCCGGTCGAAGAAACCCCAAC
GGACCAGCTCCCATGGAGCTCGGGTCCGCCGAACAGCGTGGTATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAA
GACTCCGCAGACGGTCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCAGGG
CACCCTACTGCCGAAAAACTAAGTTATCGTGATGGGTACGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTAAGAGTCTTCGTACTCTCGAATCGGCGA
GGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGAAACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACA
CCGCCAGACGGTTGCTCGTAATAGCAACAAGTTGGATGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCAACTGGCCGACGGGAAGGTC
CTCACTGTCCCCAATGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATAATATGA
TCCTGGCCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGATAGAGCATTGGT
GAGTCATGTTCTCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGAGAGTCGTCGACGTATATGAC
AGCTGCCACTCTGTTTTAATCCGTAAAGGCTTTTCTTCAATAGAATGTCTTTTCTTCTGGGAAGCTTTAGTCCTGGTGGCGCTTTCATTATTAGTTTGTC
GAGTTCCGCCTTCAGATAGGCGTTTGGAACGTCCCCTTGCCGGCCCTTGACCCTCCCGATCGCGGCTAGAACGAAAAAGAAACGCAGACTTGTTAGCTTG
AGCACCGGGGAAAACGTCTCGCTGAAGTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGGGATGGCGCTTCTCTAGTGGGTAACTTAGGTCCACAAGCGGGTAACTTAGCTCCGCAGACAGCTG
CAGCTGTCACGAACACTGAGAACAGCATGCTCAGAGTGGGTAACAGAGTTCCACACACGGTCGCCCAGACCTAAACTGAAGAGAAAGACGTCGGATATGT
TTCCCGTGGGTAACATAGTGCCACACGCGGTCGCCTAGACCTTAACTGAAGAGGAAGATGTCGAACACGCTTCCTGTGTGGGTACTACACGATGCCACAA
GTGCCTCGGATGTCGGAGCGCCGGCATCCCCAGACATGGGTAGCCGGGCTCCACGCCACGGTCGCCGTCGACGACGACGCCGCCGCCGCCACAAGTCGGA
TCCGAACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGAGTCTAGGACCCGGGCTCCTCCGACAAGGCCGATGGAAGAATGTTATCACATCTTCGAT
GGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCATTTGGAGCCGTTGCTAGATATCGCAGAGATACTGGACCTCGAGGAAATGACGGTCGAGTCTT
TCCTGGCCAGCCTCAAGGCAAGAAAGGTTGCCGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACCCCTCCTCTGTCTTGGACGAGAG
CGTCCTGAAAGATCAAAACAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTATGAGCCCCAAGGATCCAGTGTATCCTTTGGTGACGGAGTATGCGG
ACGTGGTGAACAAACGCCCACCGACCCAACTCCTACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCATGAGGCA
ATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATACCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGTAATCCCCGCACTCGACG
CCGACTTTCTGCGTTCGGAAGCCGAACGAAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGGCGGCCCAAACACCAATCCCAC
GAAAAAGGATGTGTTGTTAAACAACATGGCCTGGAGCGTAATGTACAGTGCGCTGGATTTGGAAGACGGATACTACCAGATCCTGATGCGAGAGAGCGAC
ATCCCGCTTACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGACATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGG
TGACGCAATTGTTCCACCCTTTGAGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGACAAGACGGCCATGGAGGT
GCATCTAGGACACCTCCGTGGAGTGTTGGACGTAATGCGAGCAAACAAGCTCTACGCCAACATCGACATGCGTTTTCGCGTCACCAGATATTAAAGTTCT
CGGTTGCTTCGTAAGCAACGTGGGTGTTCGGGCTGACCCCGACAAGGTCAAGGCCGTAGCAGCATGGCCAACGCATCGATCCCAGAAGGATCTTCGAAAG
TGATTGGGCTTGGGCAACAACCTTCACAAGTACAGCACAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGGGTCGCCTTCAGAAGGACGTCGACTGGTGCT
GGGAGCAAGATCACCAGGATGACTTTGACAGCATCAAGGCCGTCTCCTAGAGGCCTTTGTCCGGGTCCTGCCGGACGAGACGATGCTGTTTAGCGTCGTC
TGCGATGCCTTCGGTTGTGCATTGCTGCAGGCCGACACGGCTGGACATAAACGAGTCATCTCGTTCCAGTCCAGGCGGCGCAAAGCCGACGAACGGAACT
ACCCTGTCCACGACAAGGAGCTCCTGGCAATGCAATATGCCCTTGTGAAGTTTCGGGTTCACCTTCTGGGCTCCCGACCCTTCGTGATCTACACAGATCA
CGCATCCTTGAGGACGGCGACAAACTCGCCTCCCCTCTCCCAAAGGATGGCGAGGTGGGTGGTATTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAG
CCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATGCGTTGGCCCACATTACACGGGTGACAACGGATCTATATGATCGGATAC
GCATGGCGTATTGAGACGATGAGACTGTCACGCCTATCGTCAAGCTCCTCACGGCAGGAACGAGCGCGAGGTCTGACTGGCTTTCGTCGCGACGGCGCTC
CCGGATCCACCGATATGAGTTGAAGGATGGTCTCCTCTATTACCGGGTGGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATCGGAAT
TTCGACATCCTCGCGGAGGCGCCCGATGCGCCCTCCAGCGGCCAATTGGGCCGCGAGAAGACCTTCCTGTCGGTCTCTCAGGCCTTCTGGTGGACTCACA
TGTACAAGTGGGTCGCCCGATACATCAAGATATGTAAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTTAGCTCCACTACAGAGCCTGCCCGTACC
GGCTGACTGTTGGAAGTCGATAAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGC
AAGGTGTACCATCTTGCTCCGGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTACCACGGTCTCCCGGAGA
CGATTGTCTCGGACCGAGACCGCGGTTCACGGCTGCGTTTTGGAAAGCGCTGTTTCCTTTAATGGGAAGTCGTCTGCAGATGTCTACTGCGGACCATCCA
CAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGCCACTCTGCGCAGTGTGTGCACGGCAGCACTACGTACGTGGTCGACGCAGCTTCCAA
TTGTTGAGTTTGCGTTTAACAACGCGATACACGCGTCCACGGGGCTCACGCCGTTCTACTTGAGCGGCTTCCGCCAACCCAGAGTGCCTCTAACTCTTCG
AGGACACGCTGACTCCTCTATTCTAAGCGGGGGAGAGGCTCGGAAAGCTTTTTCCCCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGCG
GAATCCTTTATGGATACCAAGCTGAGCATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGATAGACAAAAGGAGTACTCCGACAAACATGGAA
GAGGAAACTTAAGTGTATTTAAAGTGGGAGACTTAGTGCTACTAGACACGAGGAGCCTACCTCTTGACACTGTCAGCTCTATCGACAGCAACAAGCTGAA
GCACCGCTTCATCGGACCATTTGCAGTCCTGGCCATACACGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACTCGACGCTCTATTTT
GGACGTCTTAAGCGGTACTTTGATCCGCAGG