Description :
From Genome Similarity Track
Location :
Scaffold_38:126078- 128904
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_08491Hypothetical protein
Sappa_CBS223.65SPRG_08492ribosomal large subunit pseudouridine synthase B

Sequence
2826 bases(100 bases per row)
GCCGACGAGCCGCCGACGGCGGGGAAGCGGGACTTGCGCTACAACCCCGATATCCAGCACATGCCGGCGTCGACCAGCACGGGTGGCATCGGCTACTTCC
AGTCCAAGACCGAGCGCGAGTGGGAAGCCGACCTCGAGGCCATGAAGCCCAACGACGTGTCGTTGGTACGGGCCATATTCACATATTCACACGCTTGCCA
TGCCTCATGCATCATACCTCTGTAGGACTTCAAGGCGATTGGCGACCATCTCAACACGCTACCGCCCGCAACGCGCTACGGCATTGACCCCAAGTTCTGC
GTACGTCCCTGTGTTGCGACCATCCCATACATGACGACCTCGCAGATAGATCTGGCCTTTGAAGCGCCTACAAGCCCTGTGAAATCCACATTGCAGCTCA
CGCCGACGCCCACCGTAGCGGTCCCGACGGCACCCGTTGCCTCTGTGGCCAAGCCCGCGGTAGCTGCGGCGCCCCAACCTGCCACGGTGGTGGCCAAGCC
CGCGGTCCCGGTGCTGCCCAACAAACCAGTCGTGGTTGTGGCCAAGGCGATGCCACCTCCGACGCACGCCGCTCTGGACGACGAGCTCGACGAGCTGCTC
AACATGTAGATATCGTACTTGCTTGGACAATAATAAGCTAAGGAATCATTCCATTTGTTGACATCTACATCGACTAGTCTCTAATCCTAAGGTACCAATA
CGCGGTGGTGGGCTTTCTTCATACGTGGTCGTGTGTGGGGGATGCTTATAATGACGTCGACGCGACGGCGTTGACCACGTCGATGAGCTTGGCCGGCTCG
CGGATCTTGGGGGCGACGACCGCGAGGAGCTTGGCGACGTCGACAAAGCGCACTTCTTCCGTGACTTTGTCGCCGTTAAAGGTCATGTGCGAGACCATGT
AGAACGGGAACATCTCGTTGTTGTAGTGGGGCGCCAGCTGATGGAACGGCGACGAGAGCACGATCGAGGACGGGGCGTTCGGGCGCAGCGACGCCTCAAT
GTCCCACTTGACCATGGCCTTCTCGTGGCCTTGCCATTCGACCGAGAAGTTCTTGATCTTGTAGTTGGAGAAGACGCTGGCCGAGATGCGCTTGTTCTCG
ACGATCGAGTCAATGTTGGTGAGCTTCTCGCCCGTGACGCCGTCCATAATGGTGGCGTTCGGAGTCCACACGCTCTTGGCCGAGGCCTCGAACGACATCA
TGCCTTCGTTGATGATGGCCTGGATGAGCTGCAGCGTGTTGGTCTGCTTGGCACGGAGCTCCATGAGCGCCTCTTCCGTCATCGCCTTGTTGATGGGGCT
ACCGTCGCCCCGGCGCATGATCTTGGTCTTGAGGTCGCTGTTCTCCTTCTCGAGCTCGTTGTTGCGATCTTCGAGAAAGTTCAGACGATCTTGCTTACGC
TTACGGCACTTGCGGACACGCTCGCGGTTCTTCATGCGGCGGCGCGCGTCGAGCTCGTCTTGCTTCTCCATCGCGTCCGAGCCGCGCGGCGAGTGCATGC
CACCGGACCCGTTCGAGACACCCGAGACGTTGCCCATCGACGGGGCGGGCCACCATTGTGGTGGTGCATCATCTGACCAGGGTGCTGCGGCCCACCGTGG
CCACCTTGGTTCCGGTTCAGATACTCGTACATGAGCGGGTGCATCATGTCCGGGTTCATATGCGGATCTGGTTTCATAGAGGGTTGGTGGCCGTCCATCT
GCAAGTAGGATTGCATACCACTGCCGTGCGGCGGGCCAGGGTACCGGCCGCCGGCCTTGGGCATGCCCTGGCCTTTCGGCGAGTACGACATGTGGCCACC
CATGCCCATGCTCGCGCGCGGCGAGAGCGGGAAGCCGCCATGCTGGCGCGACATGTAGTCGCGGGGCGTAAAGCCCGTGCGCGGCGTAAAGCCCGTCCGG
GGCGTGAGGCCGGTCGTGAAGCGCGGCGTGAGGCCCGTCTTGAAGACACCGAGCGGGCCGCAAAAGTCGCGGAGGTCGTCCATGCCGAGGTTGCGGGGCG
AGAGGCTGAGCGGCTTGTTGCTGTCGTTCATGCTACCACGTCGATTGATACACGGCAGCGCAGTAATGATCGAGTACCTCGAGTACGAGTCAACGTGTGT
TCGTGACTGTGGAAATTGGCGAATGACGAAGTAACTCGTAACAGACTCTGTGAGTGCTTCTCGACACTGACTTACTCACGCTATGGCGCCGACGGCCGCA
CTTGATTGGTTACCGCGCGACGGGCGCAGCTGTTGCTAATCCTGTGCATACAAACGCCAAGACGGTTGGGAGAGGGCCAGATCGACCCAGTTCGCGGGGT
TGTATTTTAATGGCGGCGTTTTTAAAATGATTTCTAAGATCTTAGTCCGGTAGCCGATCTTATTTCGCGTCGTGCACGAGGTCGGTGTAGCGCGCGCCCA
CAGCACGCGGGGAACGCGCCTCGAAGGGGGTACTATTATTGAGAGCATGATGCAGACGGTCGTCCGTTCTGTATTTGCCCGTCGTGCGAGTAATTGGCGC
GAATCAGAGAGCACGCCACGCGGCGAGATCTGGGTTGTTTGTTTGATTCAACCCGAATCGTCCCGAAGCCACTGGATACAAAGACCGAGGTACGATGGCT
TCGGTGATGGTGTTTTAAACAATCGACTGGGTGGCGACTGGGACAAGCGAACGTTGAAGCTGGGACAGCACGCGCAGCTGCGCCGATGCAAGACTCGGTG
GACAGGGCCAAGGCGCCAATGGCGAGGGCGGTGAATTGAAGCGCAAAAGGCGCGTTGGAGACCGTACGATCCGCCCCGCGTCATTACGTGCCGTTTCTTA
CGAGACGCATCCCGGCGTGTAATTCC