Description :
From Genome Similarity Track
Location :
scaffold_30:126029- 159591
Transcript NameFunction/comments
g2276.t1hypothetical protein
g2277.t1 hypothetical protein PHYSODRAFT_566381
g2278.t1 hypothetical protein PHYSODRAFT_533462
g2279.t1 hypothetical protein PHYSODRAFT_289190
g2280.t1hypothetical protein
g2281.t1 hypothetical protein PHYSODRAFT_307593
g2282.t1 DNA ligase, putative
g2283.t1 conserved hypothetical protein
g2284.t1hypothetical protein

Sequence
33562 bases(100 bases per row)
CGACGAGCAGAACGCACAAGTGAAAATGTGGCAACAGAACAGTCAATCAATGAATAAATACATTCCAGCGAAGTTTCATCAACCTCATCAACTCAACCAA
CGCTGGCGCGTGGAGGCTTATCTCCATTGAGCCCCCTCGATTTCTGCAAAAACCTCCTAGCAGCTGCCTGGGCAACTGGACTCGACAGCAGTGACACACC
AGCACCGCTAGCACGGCCCTCTTCACGGTCACCTGAGCGCAAGTCGCGTAGTAGCTCTCCGAACCCGCGTCCGTAGCTTAAGTCACTCGAGAAGACGTAC
GCCCGCCCCTCTCGTTCGAACAGCCTGCCCAGCGTAGAATCCACGCCTCGGGGCCGCTTCGAAAAATATATTGGCACAATCGTCTTGCCCTTGTCTTCAG
CAAACGCCAACTGGTCACTCACCAGCTCCGTCTTCACACTTCGCTCCGAAAGCACGACCAGGAAAACCGAGCTCTGCAGGATAGCATCCTTCGCTGCCAA
GATGCGCTCCTTGGTGCTGGAGACATTAGTCATTGAATCCACCACAAACGGCAATTGATGACGACGCAGCTCCGTGCACAAGCGCGTCACAAAGTCGCGA
TGGCAATCGCCGTGCGATACGAAGATCGAGAATGTAGGACCTCCTCCAAACGTACTCCGCCTCCCACTACCGCGCACGACCACGGCATTCACTATATCAT
CCAACCGACGATGCTTGAGCGTTGAAGTCCTTACTATTGGTTGCGTGTACCTACTTGCCATCGTTTGAGCAAGTTCTCGACTGCCTTCCAACCGATGCAT
CTCAACCTCGTCACGCAATCCGTCAATGAGACTTCTGAGGCTAGCCTGAAACTTGTCCTCATCAATTTCAAACTTCAAACGGTCCATGGACGATGAATCC
GACGAGGTAGAACTGTTGTCGCTAACTTCTGGTATTTTGGCATGACTGGAAGTCACGGCCTGGCCGAAAGGCACAATCTGTCGCGTGAAAACAAATACCT
GCAACTCTTCAGACATTTTGACGGCTTCACACGATATTGGCACCACCGGTACTTCGTGCTGCTTAGCAAATGCAAGCTCATCCATACACAGTATGCTCTG
CGCATACCCATTTGTGAGCATGCACACGATAGCAGAAGCGTTCTTCATCACCCCCAGCGATTCTTCTGATGCACCACCACCCTCGTTACCCACAGCATCT
TCGTGTTCATCGCGCATATACACTGTCATGAAGTTTTGTTCAATACCAGCCTTTACACGCTCAGCAAAACCGCCAAACACCGGGTCGAATGATAACACAA
CATCGACACAACCACCTGCGATCTTGACTACGTACTGTAGTTCAGCCGACGCGCAGCACTCGATAGCCCGACGTCCATCCCCATTCAGCGCGTACAGGTC
AGCTTTACCTTCGACTAGTAGAGACAGCGCAGTCTCCTTATAACCGAGCCGCAATGCAATGTGGAGAGGAGTCTCCTCCATTTCATTTGGGACAAGTTCA
CTGACATCCGCGCCAAAACGGACAAAGAGTTCTACGCAATCTCCTCGAAGTAGACCCCCTTCCACAGCAAACGCTAGCGGGGTCATTCCGTCATGGTCCA
ATTGCAAATAGTCTGCATCCACAGCGAGGAGCTCCTCTACTGCTCCAGGATAGTTGTGGCGAGCTGCCCAGTGCAGAGGTGTCCGTCCATGACTGTCCTT
AGCATTGACATCAGCACCGTGTTTCACAAGTTCACTGATGACACGCTGTCTTCCCATCACAGCAGCCCAGTGAAGAGGCGTACGACTGTGGGCGCCTCGC
TGAAACTCGCCTAAAACATCTGGGCTAATGCCCCACGACAGCAAATGGTTCACGGCAGCAAGGTTTCCTGCAGCGGATGTTTCGTGCAGCGGGGTGAGCG
CAACATCAGCTCCCCATTCCTCTAGCACTGCGGCCAGCTCGCGACGGCCCGATAACTGCGCTCGTTGAAGCACAGTCGTGCTGGCAGCGTTACCAGACCC
CGGAACTAACAGAATGTTGGCTCCGTGCCTGATGAGACTTTCGACGACGTCGGCTGAGTCAGCTAAGAAAATCGGGGTGACACGCATCGAACGAGAGAAA
AAGCTGGACCGCGCAATGATGTCCAAGTTGGCCCCATGCTTCACCAGGAGATCAATGACCTGCGTGTGGCCGTGCAAAGCGGCCACATGCAGAGGTGCTC
CCAGTATATGCGTCACTTTCTTCACTCGCAGCTGACACAGCTCGTACAGCAGCTCCAAATTAAACGTGGCGCCAGATATTTTATCGAGAAAGTTCGGGTT
CAGCCCTGCTTCAAGTAGCACCGAAACGACTCGAACATCGCCAGCTCGACACGCCACGTGCAGAGGGTTCTGCGTTCGATGCGAGAACATCCAACATACC
AGTGACGGCGTAGTGTACATTCGATTGAGCAGCATATCCAGCTGCACCTTGGATCCGAGTACGTGTTCAGCGCGCTCCAGCAGTTTCTCCACGGCTGCAC
AATTTCCGCTCGCTGCAGCGTCGTACAGCGCGCCACGCAGCTGCCTCTCGACCGTGCGCACGGTACTCGGCGTCGTGGCCCACGGATGCAGTTCCTGGTT
CAGCGTCAGGTACGTATCCACATGGTTTGCCTGGAGAATGGGTGTGTTGACTCCATTGGGAGCGGAGTTTCTATCGTCACTTCCGGCAGTAGCATTCCCC
CCGGCCAGTGCCGTCGGAGCCACTGCCATCAACTCATCTTCTTCCAGCCCGGCTCCAAGCTGCAACTGCTGATGGGCGCGCAGCTTGTCGAACTGCTGAG
TATGCAGCGCGATGGTGAGAATGGCCAGCAGCGTCACATACGACACGGGGTCCGTCCAAATGGCCCACACGCCTTCCTCCGTGAGGTCTCCGAAGGCCCA
GTACACGCCCAGCATGAGTACGACGATCCACGTGAGAGAGACCGTTTGCACCACCACAATAGCTTCGAACACGGCCAGCGTCAGTGTGCGCTCCAGCGTC
ACGCCAGGCCCATCGAATGCTGAGCGGGTGAGCGAGAAGGAGCTCACGGCGCGCGAGCCCAGCAGCTGCTCGCTCGTGGTGGCTGCGGTCGTAGACGTCT
CCACAATCGGCTTTTCGGCCTCGTGAACGCGGTAGAGCGGCACGAAGGGCATCGCCGCCAGCCCCAGCGACACGTTGAGCGCCTGCAGACCGAGCCAAGT
GTCCAGCACGAAGCCCTGCTTGCTGGAGAACCAAAGCAGCAGCAGTGAGCCCAGCGACAGCAACGACGTGCAGGCCACGCGCCACGTGTAGTAGGAATTG
GACCACTGCAGGTAGGCGTCGGCGCCGCGCCAGCCCCCGCGAGCAGGAGGCGTCGCGTTGGAAGCCATCGCGTGTCGGAATGATGCTCAACTCATCGAAA
TCCTGTGAACACGCATAAAAGGTAGTAAATGCGAATTTGAGAGGGGATGACAAATTCCGACCAATAAGAGAAGAGCAGCTGCCAACGGGTCGAATTCCAA
TGCATTTGAATAAGACTGGCTTGTGTTTTGTATGGGATTTCTCGGACGAACGCGGTGGACTATGTCAAGCCATGTGTGCCATTGCTATATGTATTATGTG
CTCATCAAAAATACTTTAGATGGCCACTAAGGCTCCACGCGATCCTTCGGAGAATGCTTGGTAAACACGCACCATACTCACATGTCCCGAAACGAAACCG
CCCACGATTGGTGGGATATTTAGCCAATCGCAGTCGGCTAAAATCAGCCCGACCTGTCTGACGAAAGCAGCCAGAAACTCCGCAACACAGACAATTCCCA
CTGTAGCAAAGCTTGAGAGTCATTTTCCGGCATACAAAAGGCGGTCGTTCAACCAATCAACCGAACGTCCGAACGCGACTTTCACAAGGAAGAAAGCAGG
ACCAGAAGGAGCGCACACGTTGCACGCGCAGCGCTCTGTCGGACCGTCGACAGCGCCAGACCGCAGGGGCTAACAGCAGCAACAGGCGCAGCACACGTAG
ATCTCCGTTTGAGCTGCTCGCACCGACAGCAGACCCGTAAAGCAGCAGGAACAGGTGGACAGGCAGGTCATGGCCAAACGCATTCGAGTGACCAAGCCGG
ACGCGCCCGTGGGCTTCGTAGACGTCGCCACGACGTCCCCAGTGCTGATCAACACTGCGCCCAAGGGAAAGGCCCCCACACCTACGAACGCCGAGGGGAA
GCACGTGATGCTGCCCGCGTTCCTGTCCAAGACGTACGAAATCTTCAGTATGCCCGAGTTCTCGCACGTGTGCGGCTGGAATGCCAACGGAGATACCATC
ATCGTGTCGCAGCTTGAGGCCTTCGTGGCTATGGTGCTGCCGCGCTTCTTCAAGCACCGCAACTTCCCGTCTTTCGTGCGCCAGCTCAACCTCTACGGCT
TCCACAAGACGGTGCTGGATTCAAAGCGGCTAGAGTTTCAACACCCGTACTTTAAGCGCGGGCGGCCGGACCTGCTGCACCACATCAAGCGTAAGGTTTC
CAACAGCAGCCACCACAACCAGCAGCTCGTGAGCACGTCGATTCAGGTGGGTTGATTGGCGACATGCGATCGATTCGTTGGGTGATGTTCTAATGTCTGT
TTGAGTATTTTGAGCAGAACTCGCGACTTGATGCTCATCGGGAGATTTCCGACACGCTGCTGCGGGAGATGAAGGAGCTGCGGCAGCGCAGCGACGCCAT
GGAGAAGCGTCTGCGTGACCTGGAGATTGATAACGCGGTACGGGCGACCGGTTCCAGAATATTAGACAGTGTAGCTATTGCAGGGGCTGATTATTTTTTT
GCTGCGATAACAGATTGTGCGGAGCGACAACGTGAAGTTGTGGAAGCACCTCGAGTCAGCGAAGGACAAGCAGCTCATTATGCAGGAGAAGATGAAGAAA
ATCATGTGGATTCTGTTTCAGATCTACCGAGGAAAGCAGCAGAATCTCCCCAAACTTTCTGGCAACGACGTTGCGGGTGCTGTTGTCAGCGAAGAGTAAG
TGCCGAAGGCGTGTTTCTGCCAAATGGAGTATGCAATATGTGACTAACCAGTTTTTGCTGCTGTGTGGTGTTTGCATTTCGCGCCTGCTAAACGTTGGCT
TCGAACTACCAGTATGCTTGGACCAAAGGAATTCCGTGATGTGTTACGTTTCTTGGCGATGGATGACCCCCCTTTGTTGCCTGGGTCCTCGGCGAATGTA
GCCACAGCTGCGCCAAGCTCTCGGAAGCGTAAATTTGTCGAGGTGCCACCGGATGTTGGCGACAGCTATAAACTAGGTACAGTTGAAGACACCTTGTGAT
CGATCAAATTTGTTGTACTCACTTGATACTGTTTATTTTCAGATGTAGAACCATCTTCTGTCGTCGAGGTACCGAGCGAGGTGGAAGATCTCAACCCCTT
TGCCATGACTGTTCCTTCCAACAAGCTTCCTGTGGCACACCAAGATGGAGGGCAGAACAACATCCTAAGCATTTTCTCCCCGATCAATGCGATGAACAAC
AGTGTGCCCAGCATTGACCCAATGCTCGGTGGATTCCTCACAAATGGTGTGGAGACGGTGCCTAGCATTTCACAAACAAGCGCATCTGCACCGACTGCAT
CGACACCGATTGAAGCGGCCCCTACTGGATCGGCATCAACCGTATCAACCCCGGATGAAGGCGCACCTGTTGCCAGCAACAGGGACTGTACTCCAAGTGA
CTCCACGGTCGCGTCGAATGGTACTGCCACAGAGCCGTCGGCGGATGCAAACAATCAGCTGGCTTTTTTGGACGAAGAGCTGCCTCTGCTGCCTGACTCT
CACTACAACTTCACCGACGGCGAACAGGTACTGTAACACATCCTGTGGTTATGGTTGTTTGCATGATTACCTTTTTGTGGATCACTGTGTAATGGGGTGT
CTTGTTTTGGACTGCGCATTAGCAGGCAGTGATGAAGAAGCTCGAGGATTTCGAGACGTCACTACTGGACGAATACGACGTCAGCTGCCTCGACACGTTG
CTACAGGTGGGTTCTAATAGGTTTTGTATATGTGATTTTCTCTGGGAGAACATTTACTTAATCTGCTTCTGTTCTTCATTGTTGTTTTTACGAACAGCAA
CTGAAAAGCTCTGGTAGCGGCGACAAATCAGCCAGTGTTTCAGTGGCAGATCCGGAGGAGGTTGTGGTGGGACCAACCAACGCGACCCCACACGATGCGT
AATGGAGACTTATTGCGGACCAAAGTCAGCTACCATTGCGACAGTGCTCATGCTCCGGAAGCTGGTGGTGGTGATTGCGAGCACCGCCTCATCGAAGAAG
TTACATATCCACGTACATGTCAAGCGAGTTGCCGCGTGCGCGTGTCGTCACTGGTAGGAGTTGCCCAGCGCTGCAGCGATGCATGCGTGTCACTACTCTT
ATCGACTGATAGACAAGCGATTGAACACGTCGACTCGCGTCTCCTCGCCCGGTATAGAAACAGATCGAGTGTCAAAAAGTCAAGAGAAGATCAAGCGGAG
CGAGATCGCGACGCGAAACCAAGAGAAACGGAGACGAGTTCGTACGAACAAACAGCCAACAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCT
CCGAAACGATGACGAACCCATACATGCGGCTGTTTTTATTTATGCGCAAGAAGCGAGAATCGAGACAACCTAAAACGAGAACAAGAAAAATGGCTCTTCA
TGTTGTACTACTGGACTTCATCCTCTAGGTGTTGGTTCTTGGCGGCGACTAGTAGCTTTATGCCCTTCTAGTTCACTGCGAAGCCGTTGGATCTCTTTGT
CCTTCCGGCTCAGCTCCAGTTGCGCCGTAACGAAGAGAGTTGAGATGTTGGTCTCCAGTTGCTTGTTGGCGGCACCGAGCTGTCGGTTCTGCTCCTGCAA
TTGCGCGAGCTCATCTCTAAGTCGCGAGTTCTCCTTCTCCACTTGAGTCTTGAGATCCAGCGCCTCCTTCTTCTCCAACGCGCTCGTGGACGTGTCTAGG
TCCCCGTACAAGTCCTCCGTGCTCATTGTCGCCAATTCGCTAGTGACGCATACAAACTCCCAGCTACAACGCGTCGGATTTAGTCGGAAACCGGTCAATT
GAGACCATGGACTCGCGGTGCATCAAGTTCTGGGAGGATGGTCAGGTGCTGGTGGCCGCCATCTCCGGCGCGGCACGGGTGGACCAGACGCAGGGCAAGA
TTTTCAAGGAGCTGCGAACCATGAGTCGCTTTGTGCAGCGCAACCAGAGCCAGCGCTTCAGCGACGCGGCGCAGCAGAAGCTCGTGGACTGTGTGGGGCA
CTACGTGGGACTGGGCAAGCAGGGAGGCGCCATGCTGCCAGTGGCAGAAGCCACGTTTCAAACTGTGAAGGATGGTTTGGCCATGCCGTTCAACGTGTTT
GGCACCAAGCACAAGAAGCGGTTGCTCAAATGGTACAACGAACTTATTACCATCGTAGGCGGAGACGCGGACGCGGCAATTGCTGGAGAAGCTGCCAAGC
CGAACATCGAGTGGGGCGTCATGGACATTGACGAGGACGGGTTCCTGTCACTCATGCAGGTAGAAAGCGGAGACACAAACGAGAGCTTCCAGGTACAAAA
GAAGAGCGAAGAGTACAAACAGATCAAAAAGGCGCTGGAGAACAACGAAGTTACGGTCGTCACCAACGGCGACGACATCGTGGACATACGCGTTGAAGGA
GACTAGATGGAAGAAAGCTTCCTACTTGCATGGTAGAGCATAATTAAGAGTAGTCAAAATGCGTCGAACGTTGATCCCATCTGACGTTGTGCTTACGGTG
TGATGTTGCACAGTTAAAACGGACTGGCAGCACCAGTCTTGTCGCGACTCTCACTCCACGCCTTGGCGATCGTGCGCTTCATCTCGTCGTCTCCTTCGTC
GTACATGTTCTGCAACCAAAGAGGAATGAGTAAATCTGGAGTACATGCATCTCAAACACATTACAAAAACAACGCACCTTCATCATATCCATGATTCCAG
CAGACGGGTCGCTGGTGTCGGGCTTGCTGGTCTTCACCGGGTTCTTGGCCGTGAGATTCATCCATGTGGTGTCCTTGTCAGCCTTGTACAGTGAGACTGT
AACGCGGTTCTTCTTGGCGCGGATCGAGCTCTTGGCAGGGTCAATCTCTTTCTCCAAGTGCTGCTTCAACAGACTACAAGCGACAACAAAAACCCACAAG
AACCTCGTCAGATGTATTCTTCTCACTCCAATTGACCACAACGCACCGGTAGTTCTTGCCATCTAGTCCAATAATCTACCGAACAAAACCACCACCATTA
AGTCAGCTACTCCTCATTACCCATGTTATCCCCATCGAGAAAATCACGAACCTTGAGGTCGAATGACGTCTTGGTGAAATGGCACGTGATGTTCTCCTTG
GGCAGGTCACCGACGCCGTCGATGCCCGACATAACATAGACCGCCACCTTATGCTTGCCGTAGCCGTCGTCCTCCCAGCCGAAGCGACTGATCTCCGTGA
ACGTGGTTTGGTCGCCGGCCACTGGCTCCACCTTGCGAGCCGCCACCTTGACGGGCGCCGGCTGCACGGGCGTCTCCGCCTCATGGTGCGGCTTGGCGGC
CTTCAGCACCTTCTGCTTGCGCTGCAGCAGCTGCTCCAGGTCGTGGCGGTTGCCGGCCGTCTTGGTCTGCGCCAGGAGCGTCTGCAACTCCGCCACTTCA
GCCGCCAGTTCGCTCATGATATCCTCAATAAATCCAAATCAGCAAATTTACTGCCAGCAATCGGTAAATTCTAGAACGACACATATATTATACTCTGGAC
TATTTTAAACTTGATGTCAGTATGTCTAGCTTCAATGAAACTATGAAGACATATGTTTAGGGTGTCATATTATTTTAGTGTACCCACTACGCTTTTCGCG
CGCGACAGCATGGACGGAAGCGCCCTCGACTCGGTCTCTGCTGAGGCCTCTGGGGGCGTCCCGCTCGTGTCTCCGCCGGCTATAGACGTGGTCGGTCCCT
CTGCTGCGCCTGGTAGCGCAGGACCGGTCACCACGGGCCTTGTACAGCCCTCTCAACGAGCGTTTCGTTCGACTCCCAACTCCACGCCCAAGGGATCCCC
AGCGCGGCTCACAGAGGCGTCAATGGCTCAGTACGGACAGCAGGAGGTGAAGCAGACGCCCGATCGGCCGGCGACGCCAGAAACCGCGTCTTCGGGTTCT
TCGCAGCGATCAGGAAGCGACGCGTCCGAGGGCGAAAAAGGCGGCGACAGGACGCAAAATAATTGCCCAGGAGACGCTAATATGCTACAAGATGGCAGGA
GTGATGGTAGCAGAGTGCAACAGATGCAGGTGGCAGGGTGGATGGCAGGGCAAGGAGTTTCAGGACAGACCAACGGCGTTTTTGCTGTTGCGGCGGCGCC
TGCTGCTCCTGTGCCTACAAAGAAGCCCAAGAGGTGGTTCGATGTCATCCCGATGGTACTGCAGAACTTCAAGGCGCACGACCAGGAGCAGGTTAAACGT
ACGCGATGGATAATGTTGGGATATTTGTTGGATTTTTGCTGACGTAGCTCTTGTAATCTGCCATTTGGGTGTGGGGCTTTCAGAACTGGCGCTGCCGCAG
TGTGTGGTGTGTAAACTGTGCGAGAAGGCTCAAAAGGCGGAGGTCAAATGTCGACAGGATGACTGCAAACTGGTTGACCAACCTTTGTGCTCGAGATGCT
GGGAAACCTCCCATTCTTCAGACGAGAAGAAACAGCACCGGCAGCTTCCCACAGCAAGTGAGTCATTTTCTTCTTCTTGGTTTGTAATGCTGCTGTACGC
TAATCCATTTTTCTGATAAAGTTTGCCAACAGTGCGAGGTGGATCGAATTACCTTTTGGTGTGCGGATTGCGACCTGAAGTTTTGTCAAGTGTGTTTCGA
TCGAATCCACAGTGTAACCAAGACGAAAATCCATCGCAAAGTAGCCTCAGAAGGTACGTTTATCGCTGCAAACTATTCACATGCGGTCGAGTTACGCCGG
AAAGTGCTTACTGTTTGCATGTTGTTAATGTCAACAGATGCACCTGGAAGCTGTTTGGTAACATCGGACTGGTCGGAGCCCTTTCAGAATGCAATTATGC
AGATGATTGCGGCGCGGAAGCATCCACCTCCGGCTTCGGCTGGCAGTGGAGGGGATTCCATCGGTGGAAAACGAAAGCGGGATATTGAAGTAATCGTTAT
TGACGACGATGACGATGAAGATTTTGATGATGCAAGTGCGCCCCCTATCAGCAATGGAATTTCCGAGCAGCATGCTCAAAATACGCAATATGGCATCAAC
ACTGGAGCAGAGAATGTGGGAGTAGAGAATGCATTAACGCGTTCCAATGCAGTATTCTCGCAACTCCAAATGCCGAACCAGGCTGTTCCTAAAAGCACAT
TGTTCGAGCCCCCAGTTATCCAGAACGCTATGATAGAGCCTATTCCGTTTCCTCAGGAGCTGGGAACCGCATCGTCATCGCTATCATCGTCTGCTGAATT
TGGATCGGCGCAGACTAGATCTGTTGGCACAATATCGTCAATATCAACCGGAAACAATACAGTGAACATCAACACAAACGCGGGGAGCTCGCAGTGGAAC
AACGAAACAAGTCAATTTGCAGCATCTGCCTCCATGGGATCAACAGGTTATACCGGCGGGATGATGAGTGTAACACCGAGCTCGACACCGGCTTCTGTAA
GCATGGCAAATGGAGTGTGGTCGACAAATTCTGCCATTAGCACAGATTTGGCCAGCACATCCAATTCTGGCAATCTTTTGCCACTCGGGGATGCAGTTTT
TGCGGAGAATGCGCTGGTTGATTCTTTGATAGACCGCTATCATGAGATGAACCAAAATGTAACCAATATGGAGCTGCAAAGCGAGCAGCTGACCAGACAG
ATAGCAGTCGCAACGTGTCAAGGTCCGTACGCAGCAGGATCCATAATGGGCATGCTAAACAAGTTGCAGCCTGTACTGGAGGCAGCAAGAGAACGACGCG
ACAAGTTTTTGATCGCGATGATTATCCAGTCGAACGACATCATGGCTGCTGTGCGACTTCTGCGCTTGACGGAACTCGGTGATGTACCTCAGGTTCCCAT
GATTAGCCACCGGAAGTGCCTGCAGATATCCAACGAGATCAATCAGCACAAGAAGAAGCTCCTCGAACTGAATCAGCAGCTGAGTGAGACGCTTAACCTG
TCTAATGTTGTAAGTTCCAACTGGGAGAACACGCTTATTCGAACTACCAGTGGCAATATTCAGATGCATGAGAAGAGCATCAAGAAGCTGAAGAAGGACC
GCGAAGTGGAAATTGTGCGTATTGTACAGTTCAGCAACAATATCCGCGTGACACTGAAGCTGGCGTTTCAGCGTTCTGTGGAGATACGACGCCAGCATCA
GCAACAGCAGCAGCAGCAACAGTTTCAGCCGTATGGATAGTTTTGCTATCCAGACGTCACGCGAGACTGAAAAGCGAGGAGCGACAACGATGTAGGCAAA
AGACCAATTATTTAAGTGGCAAATGAATGCACCAGTGTCAACCGTGCCGATACACAAGGAATCCAATCTGCCCCAGAAAGAAGTACAGCATCCTGCGAGC
AACACATGGTAATGCATGAATTCGAGCTAACTTTTGCATAAGATAGCAGGTGAACTCACTTTTTGACCTCATGCGAGACGAAGGAGCCGAAGGACTTACC
TACAATGACATGCCACGCACCTCCCTGGGTCTCTTCGATTTCGTGCTTGATTTGCTGCGCAACCTCCGTGAAGTGGTTCTTCTCGCCCTTGTACAGTGCT
TTGAGCGCATTGGTGGCGCTAGTGAGGATGAGCTCCTCCAATTCCTTGGTTGTGTCTTGGTACACGATGCGCAGGCCACCGACAGACACATCGTCCTTCT
TTTGAGCCTTGGACATGACTTTGATCGCCGAGTTGCTGTATCTTTTTCTGTAGGAAGTCGACTTGTGCACGACCGTTGGTATCCAATCGAGACTTGCTAA
TTCGAGCAAGTTGGCATTTAGTTGCCGCTAACGAAACGAAGATGTCAAGGGGCAAGGACATTTTCGAGCACCTGGTGCGGCAAACAGTGCATACTGTGCT
GTTCAGCGATACATCGGATCAGCACCATGAATCTGCAAACGATTCTGTTGTCATAGTTGGTCGCAGCGACACTGAGCAAAATGCTGTCGAGACGGCAACC
GCCATGGAGATTCGCTCTGATACGCTTCTGCATCGACTAATTCACAACTACGACAACCATACTGAAAACTCATCTGAAGACGAGAGGGGCAACAACGCTG
ATGTTATCAGTTGCACAGCATGGATGAAGGACTGTTTGAACTGGTCCATCGAACGACTCAAGACTGAGAAAGCTTTAATCAAGCAGTACGTGCAGGAGCA
TCGACGAAAGCGTGCTGAGGACTGTCACAAGTCTCCCGAGATGCCTGCTGATAACTTCACAATTCACGAGGCATATGCACTGCTCAAGCTTTTTCTCCTT
GAGCGGGATCCCGACTATCGACAGTGCCTACTGCAATCCATCGAGTGCGACAACTCATTCTTGCCATCTCTCCATGTACAGCTCACACTGTACGCGGCGT
ACTTCGAGCGCACCAACGGAAGACCGGTACGACCGTGATGGTATATGCAAGTGTAGTCTCTTATTCAACTTCCGTTTGGCATCCATATTGTAGATCTCCC
TAAAAACTGACGTGGAGCCTATCCAAACGCTCTATGAGTTCTTCCTCGCCCACCACTGCGCGTCCGAGTAACAGCTAGCCAAGTAAGAAACAAAATGTAC
TGTCTCGCATTCGTGGTGCTGTATCGCTGTATCTTGGAGCAACCTACAGGTAGGAGCTGTACGTCGGCATGATGTCGTCCTTCTTGGAGTCCAGACACGG
CACCGACAGCCACGCGAAATAGAAGGCGGCGCCGCCCATCACGTGCATCAAACCCTTTGCGAACCCGAGCGCCGCGTGGTTGTCGTCGTCGCTGAAGAAG
ACGGCGCCGACCCCCACAATTGTCGCAGCGACGAGACAGCCCACTGCATACGCCGCCTTCTGCTTGTTCAGAGGGGAAATGTTGCTGCTCTGCGTGGCCA
CGCGACGGTAGATGACGCCGAGGATGTAGCAGACTACGAGGAGTCCCTCGTAGAGCGCCGAGTCCCATCCGTCCTTGGTCTTGAGCAGCCACGCGCCCGC
GAACGCCACGTAGCGCAGCACAATGTTGTGATTCTCGTCCTTGTAGCCCATGAGGTGCACGCAGAGCAACAGGAAATAGGCCACAGACAGCACGTCCGAG
AGGAAGTGCCACTGATCCTCCTTGAGGAACAGCTGCGTGTCGAAAGCCTCGGCGGCGTTGAAACAGAAGGAAACCACGAGCTGCAGCACGCCCACGAACA
GCTCGAAGTGGCGGCGGTTGCGCTTCATCACGTCCAGCGCCGGCAGCATGGCCGCGTCCGTCAGCGCCAGGAACACGAAGCGCCCGAGCTCCAACAGCAT
TTTCCTGTGATTGCGATCGCCCCACAAAAAGTATCTGACTACTCTTTTATCCACCAATCACGTCCATACCCTTTACAAACCGATATCATGTATTTTGAAA
GGTAACATGAGTGAATGCGAATCGACAGTCGCGTGATTTTAGGAACGAGCCATCAGTGCAAATTGCAAAGCACTTCTCAATTTGCGCAACACTGGATAAG
ATTCTCTCCATGACTGCAGCTTCTCCGACGCCTCTGCTGCTGGACGGCAAGGCCACGAGCGACGTGGTCCGTACGCAGCAGCTCAAGCCGCAGTGCGAGG
CGTTCCAGAAGAGCCACGGCCGCCCTGTGGGCCTCGCCGTGGTGGTTGTGGGCGCCCGCAAGGACTCGGCCACATACGTGCGCATGAAGCAGAAGGCGTG
CAGCGCCGCGGGCATCGCGTCCTGGAAGATGCGGATCTCACTAGAGCAGGACGGTAACGAGAAGCCCGCGGAGAAGGTGACGGCGGAGCTGCTGGCGACC
ATCCAGACGCTCAACGAGCGCGCGGACGTCGACGGCGTCATCGTGCAGTTGCCGCTGCCCTCGTTCTGCGACGAGGACGCCATCCTGGCCACCATTGACC
CCACGAAGGACGTGGATGGACTGCACCCGGACAGTCACGCGGCGCTCTTCCAGTTCGCCACCAAGAAGACCTCGTCTCAGCACGACGAGGCGCCGTTCAG
TTTGCCCTGCACGCCTGCGGGTTGCATGGAGCTGCTGGACCATTACAACATCCCGCTGGAAGGCAAGCACGTGGTCGTGCTCGGTCGTAGCCAGGTCGTG
GGCCTGCCTGTGTCGTTGCTGTGTCTGCACCGCAACGCCACGGTCACCATGTGCCACTCGCGTACGCAGGACCTGAAGGCGCGTGTGCTTGAGGCCGACA
TTGTCATTGCGGCTATTGGACGACCGCGCTTCGTGCAAGGCGACTGGATCAAACGCGGCGCCACGGTGATCGATGTGGGCATTAACCCCGTGGAAGACGC
CTCGAAGAAGAGTGGCTACCGTCTCGTGGGCGACGTGGACTTTGACGGTGCAGTTAAGGTCGTGCATGCCATCACTCCTGTGCCAGGCGGCGTTGGCCCC
ATGACTGTGGCCATGCTCCTGAAAAACACTATCCAGTGCGCAAAACGACGCGTGCAAAAGCAGTAAAACACAGAGGATACGAGCGACGGAATCCATTCAA
CGCTTCCTAAAGTTTGGAGACTCACCCTGGCCCAGCAAGCGAACAAATCGACTTTGCCCGGCTTCGGCTGCTAATCCTAGTTGGTAAGGCGACAATTGTA
AGTAAAGCGTTCCCTGACCCCGTTCACTGCCTGTACGGGCCCGCTAGAAATCGTCGTGATGACCGAAGAGCAAGTCCTCCTCGTCCTCTGACGAGAACTG
CCCGCTTTCTTCTACGAGCTGCACGTCTTGGTGCAGTTCCTCCCAATATCCTCCGTGTGATTGCTGAGCTAGAGGGGCTCCTGTTGCCGCTTCATTATCG
CCGTCTGCAATCTCCAGGTTAGTGTCCTCATCGTTGTCGGCAGCTTGCTTCTCGTGGAGATGGTTCACAGCTTCCTCCAATCGTTGCAGTGCCGTCTTCG
CACTAGCAGGACGAGCTAATGCGGGTTGTTGCTGATGCTGCTCCTTCGATTCACCTGTAGATGCAGCTCCGAATCTCCGTTGGCCCTGAAGCAGTAGTCG
CATGCAATCAAGTTGACCATACGCCGCAGCGATCTGTGCCGGAGTCTCCCAATCACTGTTCACAAGTGTTGGGTCTGCACCAAGTGACAGCAAATTCTGT
GCCACCGCTGCGCGACCAGAAAATGCTGCCCAGTGCAGTGGGGTATCACGTCTTTCGTCGGCGGCGTTCAAGTTTGCTCCGTGCTGCACTAGTCGAGCAA
TGATCGAGAGAGCAGCAGGCGATTCTACCGCGTAGTGCACTGGAGACCGATGCAAGTCATCAAAAGCGTTGGCGTTCGAACCTCCGCCAGGAGTCAACAG
AAAAGCTGTCATGGCAGTATCGTGCGTCAAAACTGCAAGGTGCAGTGCTGTTCGACCTTGTGAATTGCCTTGAGCTTGGAGCATGCAATTCCATTCGTAG
TTCACTTCCGTAGGAACCACAAGTTGCTTCGTGCACTCGACAAACCCTCTCTCGGCGAGGCAGTGCACTGGGTATCGTCCTGCGTTGTCCGGCGTGTGAA
GTGACAACGCTGCTGGGACAAGTGCTGAGATCGTCTCTATCGGGATAACATTCTCCGCGATTGAGTCCTTCATCATCAGCTGCTGCAAGAAACCACAAAT
CTCGACCTGGTCGTCCTCACAAGCTCGATGTAGCACATTTTGACCCTTACGGTTGGTCGCTTGAACGTCGGCACCATGGGCCAACAATTTCTGCATAAAA
TCCAGGTGGCCAAGTGATGCATACAACATCAATGGCGTATCACCGTTGCAGTCAACGGCGTTCACGTTCAAGTTTGCGCCGCAAGCAAGTAAGAACTCCA
GCATTTCGGCTCGTGATCGATAGTTTTCCTTGGAGAACGACAGCATATGCAACACACTGCGTTGCATCTTTGGCTCAACTGCTGCAATATCGGCACCTCG
CTGCTGGAGGAAAGTAGCGTCTTCCACGGAAGCGTTTTCGACTGCAGTGAAAATCGTGACTTCTTTCTTCGATGGAGATGATGGGGTAGATTTGGCAATT
GGGGATGCGAGCGTCGCTGGAGCATTCTGGACACTAGTGTCAATCTCTAGAAGCTGCTGGCGTCGTATTTGAGCACGGCGTTGACCCATTTGCCGTAGTA
GCGCAACAGAACGGGATAACTCCATTTCGTCAACATCGTGATAGCAAAGCTCAAGTCTCACGTTATCGTTGTCTTGCAAGCAAACTGGAGACTTCAGTAT
CGGCAACGCATCGGTCGTAAGTTCCTGAAGAATATGCTGGATTTCAGAGGCCAAATACTCATCGCTTGGCTCAAACAGTTGAAGCAATTTACGTGTCATC
TGCGAGTCAAAGCGAAGTCGGAGTGGTGGGAGTACCTGCTTGGAATCCATCCGCGCACCAGCAGGGGTATTTGATTTCGACCTCTCCCATGCTAGCCAGG
CACTAGCTCTTTTGAAGTAGAAATGAAAAAAATTGCCAGACATCTCACCGTCTAAATTGCCTGTTGTAGTCGCAAGCGAGCGTTGACAGTAGAAATACAT
CCTTTGGCGCTTCTGGTACTCGCGAACAAATTTCTGAAGTACTCTCGCGGCATCATGATAAAACAAAATCTGGTTCACACTGCGTGTTAAAATGTGCGGC
AGCTCTCGGTGGCTCCAGTCTTCAACGGTACTATCCACATCAGCTCGAGTCGTATCCTCCTCTGTTGTCTCAATCGGCTCGAGCAAGTCGCACACTGGTT
CGTTGTCCTCTAACGAGTCTATTGGTTCTTTATCACGCGCTTTCTCGGTCGTTCCTTCGTGCTTGAGCACTTTTTCGTTAGGGATCACCACGTCCCCCGG
AGCATCCTGCAACTTTCGTCGAGAAACGATAGCCCTCTGAATTCGTTTTGCAGCAAAAGAGCGTTTAGCCACCAATACCTTGCGCTCGATATCTTTTACC
TCCTGAATGAGACGAAGCTCGTCATCCTTTACAACTGCGCGCTTCTTTTGTCGTACACCTGTGATCCATCTCCGCCAGCACATTTGTACTTTACTAGCGA
ACACTGATACCATAAGTCGATATTGGCGAATTTCCTCAGCTCGTTGAACTTCCAAGTCAGCCAAATACTGCATCCTGCATAACTTCCCTTTCCAAATCGC
CTCGATCCTTGTCGCTGCACTATTTTCTCGTCGATTTTGGTGGTATTTGTTTACTGCTCGTGCAATGCGTCGACCATAGGATCGATACTTGATGGCATCA
AATTGTTGCTGACGCTCTTGTTCAATGTGTTGAAGTTGCTCAGCGTCGGGTTTTGATCCTGGTACTCCTTCGGCTTTGAGTTCCGCCGTTAAACGTGTTC
GGCGGGTTTTAAGCTCAGCATCATTGCTCTTTTTCCTGTGTCTCTGCTCTAGACAAAGATGTCGCCTCCTTCGCCAATGCTTTTGTATCTTTAAGGCGCT
CAAATTCTGCTTGTGGCGAAGACGTTCGTGTGCCACTTTTTGTCGACGTTGGGAAATCCCCCAGCTTCGCTGAATTTTGAGAGAGCTTTCGTACTGTTCC
TGGCGTATACGATCCCTTTCCAGCTCTTCTTGTTGTTCATGGTGCCACTTGAGCCACAATGTCTGGATCTTGAGCGCACTCATGTGCTGCTCGTGCTGAA
TAAGCTCTCGCTCCATTTTGCGGCGGTGTTGTCGATTTCCCCAGTTTCGTTGGATTTTCAATGAACTCGCATTCTGCGTTTGTACCAGATATTCCTGCTG
AAGTTGTTCGTCTTTGTGATGCTCCAACTCAGTGTTCCTCTCCATGCTTCGTCGCTGCCACCATCGATAACACGCACGTTGTATCCTCGCCGAACTTAGC
TGCAGGTTTTCCTTACACTGCCACTTTCGCCAATTCCGTTGGATCAGTGTGATTGACAGCATTTGTACGCGCTTAACTTCCTTCTTCTCCTTTTGCCACT
TGTCCCAATGTTTTTGAATTCGCTTCGCACTAAGGTCTCGTCTTATTGTCAGCTCGCGCCATTGACGCCAACATTTTTGGATCTTTCTCGCACTAGCCTG
TCTTTGAATTCGAAGCCGTTTATTTTCCTCCTCAGCTCGTTGCCACTGCTGCCATCGCAGCCACCTCCTTTGTATCATTTGGGCACTAGCTTCGCGCAAA
ATTCGGATTCGTTCAGCTTTGGCTCGCTGCTGTTGCTGCCGCTTCCGCCACCACCTCTGTATACGAAGCACACTGGAAAACACAACGCGTTGAACTTCTC
TTTCCTCTTGCTTGCGTTCGACCCATCGTCTCCACACAGCCTGAACTTTGCGCACGTTTGCTCGAACTCGTATCGCTGCCAAATGGGCATCGAACGTTTG
TTGGTGGTGGTATCTTCGATCTCGCTCGCGCTTGACCCACCGTCGCCAGGCACTCTGAATCTTGCACACATTCGCTCGAGTACGGATAGTCTCCAGACGC
GCGTTGAAAACCCGTCGTTGTTCATTTCTTCGTTCACGATCGCGGATGACCCATCGTCTCCAGACAGCTTGTATTTTTCGGACGTTGGCACGAGTGCGTA
GAGCTTCAAGGTGCATATCGAACGCAAACTGTTGGGCACACTTTTGTTCTCGCTCACGTATGACCCAACGCCTCCAAACACCTTGAATTTTACGGACGTT
TGCTCGAGCTCGGATGGCTTCCAGGCGTGCATCAAACAAAACTTGTTGCTGGTGCCTTCGTTCTCTCTCGCGTACAACCCACCTTCTCCACGCACCTTGA
ATTTTGCGGACACTTGCTCGTGCTCGGATAGTTTCCAAATGCATTTTGAAAGCTTGTTGCTGTTGATTTCTTCGTTCGCGTTCGCGTATAACCCACCGTT
TCCATACTCCTTGGATTTTGCGAGCATTGGCCCGCATTCGAATCGCTCTCAGATGCGCGTTGAAAGCGAGTTGCCTACGTTCTCGTTCGCGAGTGATCCA
GCGCCTCCACACACTTTGAATTTTCCTTACGTTAGCTTGAACTCGAATGGACTCCAGGCGTGCATTAAACAACAGCTGCTGTTCACGTCTTCGTTCTCGC
TCGCGTATAACCCAGCGCCTCCACACGCATTGAATTCTACGAGCATTGGCTCGAACTCGGATCATTTCCAGGTGCGCATTAAAAATTCGCTGTTGTTCAC
GGCGACGCTGTTGTTCTTGTGTCCATTTTCTCCACCAAGCATGTAGCCTTCTAGCGAGGGCTTGCCGTTGCTTGTTCTCCTCTAATTGAGCAAGCGCCAG
CTCTTGAGCACGCTTGATTCTTTGATGGTGCGTCCATCGACGACACGCTCGTTGAACTTTCCGAGCACAATTCATGCAACGCAAGTACTTCAGCCTGGTC
GACTTGTGCTCCAATTCCTTGTGAAACCTAGCGACAGTATCAAGCGCCAGACTCACACCTTTGCGACTTTCACACTCTGCAAGAAGCTTGACTGCAATGA
TAACTTGCACTAGTTGGGCTCGAGTTTGCTCAGCAATAAGCTTATCCTGAGCAGACTTTTCTTTTTGCTGCATTCGTATCATTCCCACGGTTCGGTTATT
GCGATGTTGACTGATGCGTTGATGCATGAAGCTCGAAGCCTTAATCAAGGCAACTTCGTGCGTCTTCGCTTCGATCTCTTCCCTTTGCCTTCGTTTCTCC
TCCTCCATCTCATGTACCGCTGAGGCACAGATTGCAGCCTTTTCCTTCTTGAGTTTTGAAAGCTGCATCTGTCCTGAAACCCAGGAAGCGATCACCTGCA
TGCCAGCCTCGACTCGACTGTGTTCCAAAAATGCTGCTGCTCGCTGGGCTTCCAGCTGCTTCTCCGCTGCTAATTGATCCTTAGCTTGTAAGAGGGCTTC
AGAGCGTGCTTCAAGCTCAGATAAGCGTCGTTGAAGCTCAAGCGCAAGCGTTGTCGCTGTTCGTCGCTGTTCAAGCTGATCTTCGCAGGACATCAACTCG
ATCTCCATCTTCTCTGCTTGAAGGTGTGCCTGTTTCATCAAAAGTTGATGTTTCTCGCTTTCTGCTTTCCTGGATAGCGCCCGAGCATCGATAAAACCTT
TGATCTTCTGCCTAGCAGCACTCTCTTCTGAAACCCTTTCTCGTTTTTGATGGGCTTGAACAATTTTGCGATGTCGGGCGTCACTTTGCAGTGCTTGTTG
TGCCATCCGATCAAGTTTGCGCTCGAGCACACGCACTTGGGTACGCGTCTTGTGAACGCGCTTCTGGGTTTCAATTCCTAGTTTCTCCTTCGCAAGCAGC
TCCTTCTGAAGCTTAAGCGCATACTGTTTCTTTTCCACCTCAACTCGCTGCAGCTTCTTGTGAAGAAGGCATACTCTGAAAAACATTTGAATCTTCATCG
CTGCCAGTCGGCTTCGTCGAACCTCAACTGCATGCTGCTGTAGTTGTACGACGCGCTCATGGTGCGTAAGCAGTTGCAACCTTTCTTCCTCTGAAGCCTT
CCATCTGCGATCTAGTTCCGCCAATCTAGCGTCCATATCCGCAATCAATTCACGTCGATGCTTCGAATTGAGCTTCATGGTCTTCTCCACGTCTCTCTTA
GCTTTTGTCCACTTTAGTTGCTCCTTGAACATAATGTTCTTGGTCAACTCTTGAGCTGCTTTCAACTTGCGGCGCAGTAAAATCTCCATTAAAAACCTTT
GGATGTCTTTCAAGGCTCTCGCTCGTCGTTCTCTTTCTCGAACGAGTTTTTCTCGACGCTGCTTTTTCTTCTTGACTTTCGAACGCTGGTGTCTCCACCA
CCGAACCACTTTTTCCTTTGCATATTCTCGCTGTCGCTGTCGAAGCGAAATGCTCACGAAGAAGAGCATACGATAGAATCGCATATGGGTCAACCGGAAA
ACAACTTTGCGTCTGGCCACCTCCTGATTGTGGAGGTATATCCTCCAGTTTCGTTGGATTCGACACGCAGCGATCGATCGGACACGATGATCTTCATCTC
TCCGAGCTTGCAATCGTCGTTGATGATGGCAATAAATAAATTTCTTGATCTTCCGCCATGCAACTGCTCTGCGAACGACCTGCTTTGCTCGTTTTTGCTC
TGCGCAAGCCTCTTTCCAGTAGGTAAAGTTTCGACGCAGCATCTTCAGCTCTCGCTCCAAATACTTTGGAGCATTCCCAACCGGAATTGTAGGCGATGCA
TAGCCCATTAACGACGAGTACGGCTGCGCTACCGACAGAATGTGGTCTTCGACCTCGCGTTGGGACACCCAATGACTCATGTCAAATGCTGCAACTTGAA
TATCTCGACAAAGTGAGAAAATTCGGTTGAACTCGGAAGGTTCGCTTTCATCGTCACCCTGATAACTCGACGATGCTGAAATATTGCTGCGTGATGAAGG
AAAAGGAGAATGAGCTGCCTGTCCAATCACCACTACTCGTGGGTTACTACGTGATGAAGCGGGTGTCGAATTCATCACCTGGTCACTTATCATCGTTGGT
GCATCACTACGGGATGAAGTTGGTGAAGAATACGCCGCCCGTTCGCCTGTCGCTGTTCGTGCATCATCAGTACGAGATGAAGCTGGCAACGAGGGTATCG
CGTCGTCTCTAATCATAGTTGATGCATTGCTACGCGATGAAGACAGCACCACATCTCCGCTCGCCATCGATGGAGCTCCATAGCAAGACGAAGGGGGTGA
GGAATATGCCACTTGATCTATGGTCGTTGTCAGCGTACTTGTACGAGATGCAGCAGGAAAAGAATGCATCACAGGGTCAGATGCCACACTGCTACGGAAT
GAAGATGACGAGAAATACGCAGCCATATCGTCGACTGATGAACTGAGATGCACTGCGTTTTCAAACGGGGACTGCGCTTCATCAATCGATCGGTAGCTGT
TAATTCTGGGAGAATCCAGACCCTCATGGCTCTCGGTCGGATGTTCTGATTCCCCTTCAGGAATTGCGAATGCGTCGTCGTTCCAGACACTTGGAAGTAA
GCTCAGAGCCATCGCGATGTTCGAAACAGCACTGCTTGATGAGTACGCATATTCATCGTCATCTGGTGTCGCTACCTCTGTTCGTTGCTCAACGCTCTCC
GTCTCGCTTGTAATGCTTTCCATCGAAACGATAGCTTCACTTTGCATAGATCTATTCGTTGGAGCAGGAGATACACCAGCACTGGATAGTATCGCTGCCA
TTGCTGGCAGAACCTCGCTCTCGACATGATCTGCTTCAAGTTCTTCTGCCCTACTTGAATCCAAGCTTTCAGCCGCGTTGGGTGGTATTGCTTCCTCAGG
CTTCAAGACTTCATCTGTTAATGCAGACTCTGAAAAAGAAAAACTCGGTAGCATTTGCAGCGCCATCGCTATACTCGACAACGCCTCGTTCGATGAATAC
TCAAAGTCGCATTCATATCCATCGTCATTCAACTCGGCATCATTTTCCACGTCATATTCAACGAACGACTCCGTCTCAGTGATTAAAGCCGCTTCAACAT
TCATCCAGTTGTCCATAGTATTACGTGAAGAAGTCAATTGTTCAATCTGGAAAGAGGAAAGTAGAGCATCAGAATCTAAAGCATTGAACAGCATTGGTTC
TTCGAGGCGTACAGAATGTCCACCCTCCTCCACCGATTCCGAAAAATCTACTTCCGTGATGATCGGGCCTGACACAATATCCAAGTTATCGACTTCTCGT
TGAGGTTGGTCCTTAGTCACAACAGGTACGGATGGTCTCCTCACACTAACCAGATTTCCAGGTCCCTCTTCGTAAACCTGCATCGTTTCATCTCGCGATG
ATCGCGCGGACAACGTACTTGCTGATCGTTTCGTCATCGGTATCTCGTCTTTCCCGCTGGCAGCTGCTGGCTCGCTCATTTGCATTCCAACATCGACGAA
TGTGCAACGATGATCGCATTTGTCCTCAGAGTTGCTGCTTCTCTTTTTGGACGCAGGTCGCTCCGAGTGAGTACTTCTGCTAGAGGATTTTGCTAGCGCT
GCTGTATCCAGTGGGGGAAGTGGCAGCACTAATCGAGTAAGTTCCACGGTGTCATCCTCCCCTCCAATTCCAGTATCAACAGTTCTGGCCGACATTTTCC
TTGCAAATCGGTGAATGTCCGATACTGGTGACGCAGCACTATCCAAAATGGTGTTTTCTTTCCCGGTAAATCCTGAATCGGGTGGACTAGAAATTGGTGT
CCATGCCGATGTTGGCGGCGTTGCTGACCTGGCGTTCTCGTTCTTTGACGGTCTTCGAACTGAGGCACTTGAGGTTGTCGATGGCAATAATTGATCGGGC
ACAGTAGGGGTTAAAGATCGTTCAGTAGGTGGTCGAGCGTCCAATTTCGCTACGGTCTTCGATGTTGGTGAGCCAGCCCACGCCTCCACTACAGTTTTTT
CACTTTGAGATGTGTCTCGCCCGCCTGTGTAAGCTAGTCGAGAACCCTGACGATCCAACCGTTGTATCCGTTCATCTTCAAATGTACCATATCCATACGA
CACATTCTCTGGCACACGGTGTTGATGCAAGTGCCTCCTATGCTCTCCATGAGACTGCAGATATCTCGGTATCATTCGAACAGCATTGTACCGCGTCTCA
AGGTCCATCAAATGTAGCAATGCTGCTGCCACACGTTCTGCTGGTAAAATTTGCCAACCTTGGAGGTATCGTTGGGTCTGAAGCGCAAACGTCTCCAGTT
TATGAGTCAATAGCCGCAACAGAGACGTCGATGACGACGAAGCAGAGCAAAATAAGGCGCCGGACGTTGAACTTTGATGACAGGAACAGAGCAGCACCTC
CGATGAGTCCAAGGATAATCCATCTACGAATGGATTTCGCGTCAAACTCACTTCAAAGTCCTCGAAAAAGCGCTGTAGCGGTGGTGAACACGCCAGGAAG
TCCGAGTCGGAAGATGCCATCTGCAGCAAATACCCGTAAAAATCTTGCTCCAGGATTTCGTGTTCACCACTAACGCCCACGACATCAGAGCCGCCAAGCT
CACTGCTTAAATACACCACTGCCTCCACCACCGCAAGTGCCAGACTGCGCATCCTATTCAGCAGCTTCACCACTCGCTGCGGCACATTTTTCTCCACGTG
CGATGCTCGATGCAGCGGCAGTACCCCCATGAGTTCTTGCTGTAAATGGGCCATCACTTGGTCGCGCAGGTGCATATTTTGTCGAATTGAGTCGATCACA
ATCTGGGCTGGCGACTGCTGTAATGGTGGCGAACGAGTCGCGCGCTGTACAGAGTTTGCATTGCTGTTGTGAGGAGATTGCTGGTAGCGGTGAGGTGCCG
CGTCACTACGAGTGCCTTGCACCTGTTGTTTGAGCTTGTAGGGACTGGAGAGCCTCCTGGCTTGAAGCTGCTGCATCTGTCGCTCCGTAAGAGGTTTGGC
CGCAGATTCTCGAGCAGCTCGTGTCTGCAGTCGTGGCTTTGGTTCTGCACTGAAATCTTGCTCATTTCCAGGCTGGAGACTTCGGCTGTTGTTTAAGTCC
CCTGTGTAGGTCGTTCTCCTGCTCGAAGGAGCCTCCGACTGCCATGTCGCAGTTTGCTGCATACCCGCTCGTAGGGTGCCTTGGTACATCGAGTCGTCAA
GCTCCAGCTCCACTAGAAGACGTTGCTGATCATGACGTCGACGGCCACCGAACTCCGTAGCTCTGCGCGGCGGGGGGCTTTTCCCACCCCACAGGAAGGT
TCTATCAGCCATAGCCTTTTATAATTAGGCGCCACTTGCCAAATGCCCACTCTTCCTGCGCGCCGCTGAGCGTTTCCAAGAAACGTTTCGTCGGCGAGCT
TCTTCATCGCAGACACCTGCACAAAAACCAACAGGGTAACGCAACAAACACAACACTAGACTGGATATGGGTGTCTTAAGTTTTACCGGTGGGACGGTGA
TCGGGATTAGCTCCACTTGTTCCTAGATAAGCATATCGCCGTCCTCCTCTTCCTCGCCAGTTGTCATAGTCGTCAGTCCCTGGGCTCGGTACAGATCAGC
AATCTACAGGAAATAGTGGGGGGAAATGAATGGTAAACAAGAGTTAGTACCGGATCATGAGCAAACACATTCAGTGCCGGAAACCAGAAGTTCGAGCGGA
CCTGTGAAGAGTTGGTCGCCTGCGTAGTCTCCTTGTCGTCACGGATGCGAATGAAGCGAGGGAAGCGTAGGGAGATGCCCTTATCCTTCGCCACTAGGCC
GATGGCTGCCGTGTATTTGGGCGAGATGGACAAATCTGCGCCTAGGATCTCCCACACGCAGCTAGCTTCGAACCAAACGTCAGGCTTGATTCCTTCGTTG
ACAGCATAATCGCTTGGCGCCTTGTCGACCACTTTCTCCTTGAGCTGCTCGTAGAACTGCTTGAGCACTTCATCCGACAAACCGGTGCCCAACTTTGTAA
TGGGTTGGTACATCTCGGTGTCCGGGTCGTAACATGCAAGCAAATACGCGCCGTAGACACCAGTACGTTTACCACGTCCGTAGAACGCACCGATCGGAAC
CAGATCAGCGGAATCGCCAATGCCGTCGAGGTAATCCTTCTTTAGCTTCAGCCACTTGTGCGAACGGTTGGCCGGTTCATATGTCGCCTCCCTCTCCAGG
GTCTTCACCATCAATCCTTCACAGTTCTCACGCACAGCCTCCTCCAGGAAATTGCGGACCTTATCAACCGCCTCTTCCATCGCCTCCGCATTATCCTTCA
CGTCGACACCATCTTCCACATCTAAGGAAGTAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGG
GGTGCCCAGGAATGATTCGCCGTTCAGGAACAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGT
GCAAATAAAATCAGAATCCAACACAACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCT
TGTTAGTGACGCGGTCCACCGCAACCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGG
GAAACGCTCCGTGGAGTTCTCAAAATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCG
CAGGTGAACGGCTTGCCCTCAAACCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGC
ACTTCTCAGAAACATTTGCGAAATCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCT
TGGGCACTCGGAGAAGGCTTTCTTGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCC
ATCAGGATAGATTTTTCGGCCAAGCCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGG
CCTTCTTTTCCTTCTCACACTTCACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTG
ATTGTACACATGCTGGACAGTGAGACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGATCGCGCATTCTGCGCA
ACCTTACCGAGATCGCCCTCCTTGTTGTACATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCAGGATAGCGTCACCAA
TGCCGATCTTCAGGTTCTCAAATGGGGGCGCCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACGACGAATGACGTCACG
GAAGAATGCAGTGAGCAGGTCTTGGATGACGAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATACGGAGTCTCACGGGGT
CCGTCGCTCTCCTCTTCCTGTTTTTCAGCTGCGTTGGCCTCCTCTTTTTTGCTCACCTTGCTCTTCGACTCGGACTCCGTCCCACTCTTTATTTTCTCTG
TCTTCTTACCGTTAGCAGGAGTCGTCTTGGTATTCTTCGCAGCTTGCAAGGAGAAGAAGCCAGCTTTCGTCGAAGTAGGTGACAATGCCTCCTTCTTCGT
GTCGGTCTTTTCAGACGCTTTCTTCTGCTCAACCTCTTCAACTTCCTCTTCTTCAGCCTCCTTCTTCGGCGTCTTCGTCTCCTTCTTGGGACTCTTGGTC
TTCACTGGCGTCACGGGCTTCGTCTCTTTCTTATTGGGACTCTTTTCCTTCTCAGGTGACGTCATGTCAATCACTTCCTTCTTCTTCTTCAAGGCCATGG
GCAGATCCATGTCGCTGTCTTCATCTTCCTCCTCTACGATCCGTTGCCGGAGACGACGACGACCAGCTGCAACAATAATAAAAACCGAACAGATAATCAG
CCACGGCCATATACCAGCAGCAAAATAAAGAGATCCACGTACGTTTCGTCTTGGTGGCTTCTTCTTCATCTTTTTCGTGTTCTTCTATGTGTTCTTCTTC
CTGCATTTCGACGTCCTCGGGCTCTTCCTCCATTTGTTTCTCTTCCTCCCCGTCTTGTTCTTGTGCCTTCTTCGCTTCTTCTTGTGTCTTCTTCTCTTCT
TCTTCTTCTTCTTCTTCGTTTTGCTTCTTCTTTTTCTCTTGTGGCTTCTCTTTCTTCGCCTTTTTCACGGGTTTATTGGCGGGTTTCTGCGCCTCGTCGT
CCGCCGGTTTGCGCTTCTTGGGGGACGACGTGGGGGCCCCCGCGCCGAAGAACGACATGATGGAGCGCTGCGTCTTGGGCGCAGCTAGTGTCACGTGAGC
ACATTTGTATGTGAGTGAAATGGGTCTCCCCCAAACAGCCCAAAATATACAGCACCTTTCTTCCCCATTGTCACTCCACGTTCGCTTTTCAGCAATTGCA
GCCAAAACTTTTTGGCGCGCTCCAAAGTGTACCCATCTCAAGCGGTGTCAATAGGCGGATAGTGGAAATACAACAATCCTATTTATTTGGCGGGAAAGCT
TTAAAAAGGGTATCCAATCGTCAGAAATGGGTCGCAAGTTGCTGGCACTCGTGCCGTCGGCGCTACCGGCGTCCGCCAACCTGGAGCGCTTCCACGCGGA
TGCGACGGACGCTCCGTTGCTCTCAGTGGTCGTGTGGAGCTCCCACGGCCCTGGGGACGCCACGCGGACGCGTCAACTCGCGCTGGACCGCGATCGGCAC
CGACTGCTGGAGCTGCAGCGCGTGCAGCCGCCCGATGGCGCGCGGAGTTGGTTTTTGGGCAACTCGGTGGTGCAAAATGGTTCCCTCACGCTGTTTTCAC
CCATGGACGCGCTTTTTGTGCTGCTGGACGCTGCATGGGCCCAGCGCAAAAGGTTCTCGTCGGTGTTTGACCTTTTGGCGCAAAATGGGAACACATGGCT
GCTGCAGCTCTCGACACTAGACCAAAAAGTGCTGGAGACGATCTGCGACGTGCAGACGGTGGGAGGAGAAGACGGGGTGGACAACCTCTATGTGAAGGTG
AATGCGGGTAAAGTTACAGGGTGGTTAAGGTCCAAAGTGGAGAAGGTGGCTGCAGTGCTGGCCACGCAGGAGAAGACGGCGGCCAAAGGTGACGCGTTCG
CGGAACAGGTAAATGTACCAGGACAAGAGGGAAAGAAAGAGTGTGCGGAGGTGAAAGAGGAAGTCGTCGCTCGCCATTATCGCGAGGCCATTGGCGTGGT
GGGGAACTACCTCCCGGAAGAGTGGATCGAGCTACTGTGCAAAGAGTTCAAGTACGTTGATGAACAGAGTTTTTGTGTTTTTTTGTTTGTTAGCTAAACG
AGTTCTATTTGTTGTTCTTAAGGGTGGAGACGGAGGTGGCGGTGAAGACTCCTGCCAAGTCGGCAACTGGTGCCCAGGACAATTTCAGGCGCTTCGACCG
ACGTCAGACACCCGAGAGTGGGTCCAAGCGCTCGACGCCTGCTACGGCTGCTGCGACCAAAAAGAAAAGCAAATTGGCTAATGTGGATCGCACCGGAATG
AAGTCGCTGACCTCATTCTTCGGCAAGAAGTAGAGAAGTTGCAGTTTTCGTTGCATTTCGCAGATATATAGAGCTGTTTATCATCTACCGTCGCGATGTC
GAGCCCTCCACGCTCACCCGGTGCACTTGCACGAAATCGCCCCAGCCAGAGAGGATCCTGAACTTGATAAAGGAGGCATCCGTTGGCTTGACATTTTCGC
TTACAATTTGCATCTCTCCGTCGGTCTCCTTGAGCTCTGGTAATGGCAACCAACCATTAGCTGTAGAGCACCAAGACAACCACATGATTTACTCACTGGC
ATCGAAGAGCTTCTCCCATTTGGTCGGGGTTGGTCCACTGCAGGCTTCTACGGACACCTCCTTGACATTCCGCGTCCACATCTTGGCACGAACTACAGAA
GCCGTCGTTGCAAGCTGAACCACGAGTTCCTGAGGAAAGCTTCCTGTCGTCACCCACTTGGACGATTGCTCTCTGCAACAACCAAGGCAGCAAGGTTACA
AAAGTTTACAAACGCAGAAGCAGGACACACCATACCCGTCCAAGATGTTGACCGGTGGGAAGTTCGGATCATACGAAGTCACCGCCGTCACCTGGGCGCC
CTCTTCATCCAAAGCGAGCTCCATCGCGACCGAGACGACTAACAGACTTTCGGGGAACTCGGCTCTTGTGATTGTGGTCTGCCTTCTGTCCTAAAAACCG
CACAGCTTAAACTTAGAACGACGCCACAAGAACAAACATAAGAATAGCTTGGGACGCACTCATACTTATCATCTCCATTTGCACAACGCGGAATGCACAG
GCGACTTTTACTTGAACACCCTCCTAGATACCGACGTCGCAGGCCACAGCGGGTGGCTTTTTCACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTCTGCA
GTCGCGGGCTCTAAATCATGTTGGAGGCTGCCCAAAACCCAATTCACTGGACAACCGCCGACCTACTTACGTTGTCAGCGGTGGCTCAATTGACTCCTTG
TACAGCCTCTCGAAACCCGCCGACAAAATGTCGGCTGCACGTGTGATACCCGATCCATCGTCATTAAAGAGCTTGCAGTTCGACCACATAAGGCGAATGT
CGTTGGCAAAGTGCGTAGAATCAAGCTCCTTGACACCAGCCGCCACTGTGTTGCTGTCCACAATGTACGCTCCCTTCTTCAGCTTATCCTCGATTGTCGA
CAAGTCCATTGGCTGCTTCACCACCCGAGTGTACATCGGAATGTTCTCCACGGGCGTGAGGAATGGCTTTGAAAATGGATGCGACTTCAGACACGTGACA
ATTTTCAGGCACTTGTCCAGCAAGCCTTGCTCTGAAGCCACAGCTGTGGAATACAAATCGAAACGAGACGGCTTCCGACACTCGGCGCATTGCCAATCCC
CCTCCGGTAAGTCACTCTCCTTCATGTGCAGACACTTTAAGTGGAAGGAGCGCGGGCACTTGTCGCAGCACACCAGATCACCAGCACCCTGACAGACCTC
ACAGAAATCCAAGTTCGTGTCCAGCTCGCTATCTGAATCATCGCCCTCGTCTTCATCATCTTCGTCGTCTTCTTCGTCCGCTTGGTTGTACGTTTCATCC
TCTGTTTCTTCTTCGTCTCGTTTCACTCGCTTGGCATTCTTAGGAGGTCTACCTCTTCCCCGCTTTGGGGGCGGAGTAGATTTACGCTCTTGTAGATTCT
TCCTCTCTGCACGAGGACCAACTGAAACACTGCTCGGTGTATCGTTTTTTAGCTGGCGCGGGCGACCTGGTCCATACGCTGGTGATGACTCCGCTGAACG
ACTTTCCTTCGGATGACGTTGACGAGCAGGGCCGTACGCCGGTGACGATTCCGCTGAACGGCTTCCCTTAGATCCCGCCTCGGCTGTGTTTGCCTTCACA
CTACCATCTAGCTGGGATGCAAGTTTTGATCTTGCATCAGGCGGATATCGGTTTTTCTCCTCATCGTTGTGTTCACTAATAGAGCTTTCATCGCGGCGCG
CTAACCTTGAATCGTTGCGTATATCGTTTGAATTACGTGGCGCTGGACTGTCCTCCGCATCGCTTTCGCTTGCTTTCCGCTTCCGTGCGTGGACTTCTTC
TGCTGACCGTGCACCTGCACTGGAGCGATCACGAGAAGTACTTTCGTCTGCCGAGTCCATCGAGCTGGTCGATGATTGATCTTGATATGGGCTATCTGCT
TGGCGGCGTCTGTTGGCAATACCTCGTTCAGCAGTCAACCGAGAGGAAGCTTCCATTTCATCGCCAGAACCTTGATCACCAGAATCTTGCGCATATCCAC
TGCTCTCCTTCCTAGCTACAATTCCATTCGTACCATAGCGTAATTCAACCTGGCGATGGGTGCTATCTTTGCTGGATTGACTGCTGGCACTCAGATCCAT
CGCCATCGACGAAGGCTCCGTATCTTGGTTCAGCGTGCTTAATAGATGGACCAGTGACTTCTCTGACTCGGCACAATTCAACACAGTAGCCGCAGTTGGT
GACTCCGCTGAACCTTGATGAACAAGCGGCGAGGCGATTCTAGCAGCAACTCGGGGATCAACAGCGTGCACACTGTCAGCGATCACAGACAGCATATCAG
TAGGAGTATCCTTTGCCGCACGCTTGGGAAGAGGAGGGTAACGAGGCAAAGGCTTCTGCTGCGCTTGCATATTTGGTGGGTAGCTATCACGTTCGCCCGC
CGGATACTGCCCGTAGTCGGACTGCTGGGTCGGTATTTGCCTGTGTCCCTCCCACGACCTCCCGTCCTCAACACCGCGAGCAGAAACTTCACCGCGCACA
ACGGGTGCACGACCATCACCTTGTGGGGTGGGCGGGTATTGAGCGTAACGGTGGCTGTCGCTGCTTGCCACATTTGGGGCACCGCTGAACGAAATTCGGC
CATCGGGTCCTGTTGGGGTAGCTGGAGGCGCGCGATTGTCCTTCACAACGGCAGTGCCCCCCTGTCCATTGCGACGAAGCGTGTCCAGGAGATAGCGCTT
ATACTTCTGGACTTCCGTGACTTTTACCTGCGTGCACGAGGTGCACGGACATCCACTCGTGCAAACCAAGCAGCGCAGCAGACGTCGGTTGGGGGCAGAG
CCGTTCCTGCCCACGAACAACGCCTCAAGCCTCACTCTGTAGACACTGCGCAAATGCTCGCGACACAGAGAATGCCCCTCATCCGCATGCGGGCAGAAAT
TCACGACAGGCACATAGTGGCTCTCGCCCGCTCCACACAAATGGCACAGTCCCTTGGCCACAAAGTTGGCCTCCTGCTCCGGAATCAAGTCCTCCATGGC
CACAGCGAACGCATCGTGCAGTACGGACTCGTCCAAATTCACCTGTTCTCGGAGCATCTCCTCTACTCGAGGGGGCAGCTTCCTCTCTCTCTTGTAGTCC
TCCGCCATCTTCCCCTTGAATCCCGTCGACGCCTCCGGCAGTTGCTGAGACCCTGTAGGGCGTTGTTGCATGACCCTCTCCTGATACATATCCGCTCTCC
CCTGAAACCCTGTCGTTCTAGCATGGTACCCTGCAGTCGTTCTACCTTGGTACCCCGCCGGCCCTTGGTAGCCCGCTGCATCCACTGTTCTCGCCTGCGC
GTAACCCGTAGCCATTCTCCCTTGTGCGCTGTAACCTGTCGAGCTCTCAGCCACTCTCCCTTGGGGTGGGTACACGGTAGAACGCTCTACCGTTCTCCCT
TGGTAGGTAGAGTACTGCTGATACTGTGGGGGGGGTGCCTCCCGGTCCGGGGCCCTCCCCTGCCAAGCCGCGGCCGCTGTGGCAGGGACCACTGGCCCCG
ACGTAACCGGTACGTAACCCTCTGGCGCCTTGCCCTTGCTCATAATGGCCTCCATCCACACTTCGTTGGGCGGGGGCGTGAGTCGCTGACGTTTCTGTGG
AAAATGATTCACAGGATTCACAGGTCAAGAAAGAAAAGTTAGACGGGGAGGAAGAGGCCCGTAACACGCCGCTCCGCACCTTGTCCCCGTGGTCGCGAGC
CGCCCCATGGTACATGCTGACCGCTTCCTCGCGCGAGGCGTCGGCTGCTCGTCCAGGCTTCGCGAGATTTGTTGTCACCACACGGTTTTGCCGCGGGTTG
TGGACGCGAAAACGCATACATTCGCGAAGAAATATGGAATACGCTGTCAAGTATGCGTTTTCGGAGGTACCCATCTCAGAAGCTTTCCTGCTCTGGTTTA
CTGTGCATACAAGCATCATCGCCAGCGCCGCACAAACATTGCAAACCTGGCAGCGTTTCTCC