Description :
From Genome Similarity Track
Location :
scaffold_60:126021- 127254
Transcript NameFunction/comments
g6705.t1 hypothetical protein PHYSODRAFT_475220

Sequence
1233 bases(100 bases per row)
CTGGAGCTAGAAGACAATGACCAACCGCGCAGGCAAAGTGGGCAAGACGTGGTGTGAACCTCTTTGATAATTGATTCGAACTCGATGCAATGGCGAGTGC
GGTATTGTGCAACTCAATTCGCAGTCACCATACCTATTGGAAACGACTCAAGCGGACTATTTCAGCGTTTTCATCTCTGCGGCCTGAAGCGACAGATCAT
AATGGAAAACCAGAAAGCCAGGCCAAGGTTAACACTCCGAGTCTCGCTGCTGGGCCGCGCCATTCTTCCCGACAAGCATCATCATCATCTGCATGAACTG
CTCGTGTCTGCGGCGGTTCTCGGCGCGCTCTTCGGCGCGTTCTTCGTTGCGGCGGCGCCTCGCCTCGCGCTCTTCGTCGCGTCGGCGATCCTCTTCCTGT
CTCCGCTGTTCCGTCTCTTCCCGTCGGCGTTGCCGTTCCTCATCACGACGCGTTCGCTCTTCCTCGCGATCCAAGTCCCGCTGGTACTGCGAGCGGAGGA
CCACCTTAAGCACAGACGTGAGCAGGTCGTCGCTCGGAGCTGGCGTCGCCTCCGGTGGGAAAATAGCTGCCGGGTTCTGCCACTCCGGACTCTGACGCGG
CGGCGTACGCGCTCGCGCGCGTTGAGCAGGAGCAGGTGAGGCAGCCGCCGGAGCTGAACCTGGAGCTGCAATTGGCGCTGCAGCGGGAGATGAAGCTGTG
ATAGTGGGCGTGGTAGCAGCCACCTCGGATGCAGTGTCCACCCAGCTGTGTTCGGACTCGGTGGCTCCGTCCTGACCTCTCTCCTCACTCTGCGGCGGCT
GGAACGAGGTCTCATTGGGCTCCATTTGATCGCCATCGACGCTGGGCACTGCTCCAGGAGCGGGCGGGACGCCCTCGATCATCTCCTTGTGCACCACATG
GGCGAAGGTGATGGCCTGGTGGTTCTTGGCGCCGCGCGGCGGGATGCTGGACCTGTAGAGCCGCGAAAACTTTTTCTTCAGCGAGTCGGCCGAGCGGTTG
TGCTTGGAAAACTGCTGGTTGTGCAGCTGCGCGACGACGTCCCAGCCTTCGCGCCAGCGCGCGCGCACCAGCTGCAGAAGGCCCATGGACTCAGCCTCCG
TGAAGCCGTCCCCGCGGCGCTGCACGTGCAGTCCGACACGCCGCTTCACCTCGGAGCTCTCCATCGCGTCCGGCGGGGAAAAGCGCGCGGCCATTTTTTT
GAGGGGGACCAAAGAAATTTTGGGTGGATCAAA