Description :
From Genome Similarity Track
Location :
Scaffold_1061:1260- 3403
Sequence
2143 bases(100 bases per row)
CGATTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGT
TGTATTCTCGTACAACGTGGAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGC
GATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTAATCATC
CCTGTGTACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAAC
TCCCGTAGCCACCGTACTTCTCCGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCTTGGCGTACAGCAACGCGGGGTC
CATTCGAATAGTCGGAAAAACCCTTTTTTTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGATTGCAGTAG
CTGCGCGAAAGCAACATCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTC
GACTTATGCACCCACTCTAACGTCGAGAATCGTGTAAAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCA
AAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAG
CGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTC
AATTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTT
GAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATAGCCGCAAGCTTCTTGGG
GTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGACAAAAGATGCTCTTGGTGAAGCTAATACTGATCCGACACTGT
GCAAATGTTGCTAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAG
GTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCG
GTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATTCAAAC
CAACCTCCTTTAGGTTGAATGAACCCCCAGAGTGCGTTGTCAATCATACGCTGATAGATCATCGGCGCGTTCTTTAGCCCGAAGGGCATGCGTAACCACT
CGAAATGTCCGAGTGCGCAGACGAACGCCGGTACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCA
TAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCAGTGATAGCATTCACCACTTGTAATCAATGCAGAGCC
GGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGTGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCCGCACGCAATAAAGCGCGCAGCAG
CTCGTACAGCTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTTTGTCGATATCGCATACCGCACCGTAGGAT
GGCGGCGGTAGTGCGTCACCACTAGCAATCAAGATGTGCTCGT