Description :
From Genome Similarity Track
Location :
Scaffold_2743:126- 2801
Sequence
2675 bases(100 bases per row)
GGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCT
TCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGT
GCTAAGAGTTGGGTGTACACTCGGGAAGCAACATCTCCTGGATGTTTCACATCCTGGGATCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGTGA
ACTACGAGTACCGCCAGCGTTCGCGTCGTCTGAGTGGTGTGGCGCACACAATGGACCCCGGGGTTCCTCGCGTGTAAACAAGGAAGGCGCTAACTGCACG
AGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCTTTCGAGTGGG
CCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAGGCGATTCAAGTAGCTCTTCAAGAAGAGTACAGCCAGCGCCAGGCGCGTACG
CCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACA
TCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCG
CTGGCAGAAGCCAGGATTCCGGGGACAGGGGAACGCAGGGAACCAGTAGGAGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGG
GCGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGG
ATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAGCAGCAACAAGTTGTCCGATGCT
TTGAGAGAAAGCAAGGCCAACGTCGGTGCGACTGTACGACGGGAAGGTCGTCACTGTCCCTACGTCTGAGTGGAGCTGGCCATCAACTTGAAGGCTTTGA
CAGCCTCGAACAGCTCACTGTTCTCGATATGGATCCATATGATGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAAGCATAGCAATCAGTGCCAGCC
GGCACTGCACAGTCACGACAGAGCATTGGTGGGTCATGTTCACACATCTGTCAGGACACGGGGTGCCCGGCAAGGCTGGCAGGGTACCGAAGCATCCAGC
CGATACTTGGGAGTCGTCGACGTATATGACGACTCCGATGATGTTTTGATGGTGGCAGTGCCCAGAAAAGGCGCTGGCCAAGTGGGTAACCTAGGTCCAC
AAGCGGGTAACTTAGTTCCGCAGACAGCTGCTGCTGTCACGAACACCGATAACAGCGTGTTTAGAGTGGGTAACAGGGTTCCACACACGGTCGCCCAGAC
CTTAACTAAATAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTTGAAGCGCCGACATCCCCA
GACGTGGGTAGCAAAGCTCCACGTCACGGTCGCCGTCGACGACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCAGATCGACGTCGCTTCAA
GCGCCTCAGAGTCCAGGGCCCGGGCCTCTCCGACAAGGCCGGTGGAAGAGTGTAATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCACCTGG
TTTTCACTTGGAACCGTTGCCAGAGGTTGCAGAGATGCTGAACCTCGAGGAAATGACGGTCGAGTCTTTATTGGCCAACCTCAAGGCTGGAAAGGTTGCC
GAGATGGTGCTCATGAGACCTGAGACCACTCGAGAGGAGCTGAACTGCTCTTCTGTCTTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAGCGTCAGA
CGCGCTTGGGCTCTGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACATTCACCGACCCAACA
CCCACCAGATCGATCGAGGCGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGA
GGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAAGGCAGGCGTGGTGCGGGAGTCAAAGTCTCCGCACTCGACGCCACCTTTCTGCGTTCGGAAGCCGAA
CGGGAAGTGGCGTCTAGTTCTCGCTTATAACAAGCTGAACAACGCAGCGGTGCCGGCCCAAACATTTTTTTCACAAAAGGGTGACCCGCCCCACAACATG
GAAGTGTCCGATATTGGCAAGGAACTAGAACTCCAGCACAGATACTACCTCTCGTGTATTTCGCAGAGGGGCCCCTCAGTGGAGCAATGTGCAGTGCGAT
TGCCATGATCCTGTAGAGCTGCGTAATGTGAAAGATACTGGTCATGGTCTGCTCTACTCTAGCAGACTCATCACA