Description :
From Genome Similarity Track
Location :
Scaffold_2922:126- 2718
Sequence
2592 bases(100 bases per row)
AATGCTCCGCAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTGACGGTAAACCCGTCCGTATCTAGTTC
GCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGACGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTC
GACGCGATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATAGGTGTACTACAGGGAACAGGCGG
TATTCGGTACCTGCCGTTTCCAGCTTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCATACC
CCTCTTTCACTCGATCCATATAAAGCCACACCTGTGATCCCACTTGGATTAGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGACCCTGTATCGC
ACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGTCTTGAATCTCGGTTCCTCTTCTTGGTGCTG
CAAACTGGGATTGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCG
CGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGC
CGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCGGACATAAAGCCTGGCTCC
CGATCATGCCTAATCCTCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGG
CTATCACGTATCCGGTAAACAAGTCCACCCAAATCAACAATTCTGAGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTG
GAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACGTATCGTTGT
ACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGT
GTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGGTCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTC
ATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTATGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCC
AAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTAGGGGTTGGATCCAATCCTTC
CTCTGGACCTAGTGACGGCCATCACCTGGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCT
CGGCCTCTCTCTCCACTTCAACACCACATCGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGTACCAACTC
GTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCCGTAACAGTGTTAGGGCAGGGCCTTGCAGGCAATCTCACCTCGTACCTGTCTGATCACCA
AACTTAAATACCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAG
GCCTTCCGCATAAGTGGATCTGGCCCGTACTACTTCCCATCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTATGCGAGCGGAT
CCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCA
GCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCCTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGG
CGAGAGTAAAGCTGCCCACTGTCCCAAACGTCTTTGTAACCCGGCTGACTTGAACAGCCAGGCTAACGTAGAGTGTCGAGTCAGGATCCGGATGGATCTT
CCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAATTCATTCGGCTTCAGTGTCCGGC
TGACGAAGGTGACTGGGATGACATATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATAACCGTAGG